More Fields
Strain Species Genotype
PS1009 C. elegans unc-101(sy237) I; sli-1(sy143) X. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1411 C. elegans let-23(sy1) II; sli-1(sy143) X. Show Description
sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2728 C. elegans sli-1(sy143) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS746 C. elegans let-23(sy97) II; sli-1(sy143) X. Show Description
sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS8630 C. elegans oac-44(sy1431) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTCGGATTCCACTTCTACCCAAACCAGTTTCC right flanking sequence: CAATGGATACCTCGGAGTGGATCAgttaggtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCCAAACCAGTTTCCCAA Method Reference: G3 (Bethesda).
PS8632 C. elegans oac-42(sy1433) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-42. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTGACTTACAAGGAATTCGGGGTCTCGCCATTG right flanking sequence: CTGCAGTGCTTCTTTATCACTTTTATCCAAAACAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGAAGCACTGCAGCAA Method Reference: G3 (Bethesda).
PS8634 C. elegans col-135(sy1435) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda).
PS8636 C. elegans ins-10(sy1437) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda).