Heterozygotes are WT and segregate WT, Unc and dead embryos. eT2 homozygotes are embryonic lethals.

Unc. Egl, Lon, Slow and Floppy.

Unc. Semidominant Egl-c, Sma.

Unc. Semi-dominant Eat (TB relaxation defective).

unc-124 is a cold sensitive kinker Unc.

unc-2(e55) is very inactive. gm83 is a Unc (forward kinker). Double shows both phenotypes.

Heterozygotes are WT and segregate WT, DpyUncs, and peb-1(cu9) homozygotes which arrest as larvae with a stuffed pharynx, abnormal hindgut and g1 gland cell morphology, and molting defects.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Slow moving Kinkers. Slow growing.

Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Dpy. Unc.

vaIs33 [unc-2::GFP + lin-15(+)]. Superficially Wild-type.

non-Unc hermaphrodite strain. yDp14/+; unc-2 males are 60% inviable. yDp14/yDp14; unc-2 males are dead.

non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost.

C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430

Deletion flanking sequence (X: 764793) AGTCAACTACTAAAAAACGT-TTTTTTT-TTTTTTCAAATTCTAGAATAAGTT (X:765504). 667 BP DELETION. 7 T insertion.

pe572 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228

pe577 mutants exhibit defects in salt chemotaxis after low salt concentration with food conditioning. Reference: Park C, et al. Elife. 2021 Jan 25;10:e55701. doi: 10.7554/eLife.55701. PMID: 33492228

lqIs2 [osm-6::GFP] X. lqIs2 carries a PDE/amphid/phasmid marker linked to mig-2. Reference: Struckhoff EC, Lundquist EA. Development 2003, 130:693-704.

Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgtctgatgtagaagtttagttgttgtgg ; Right flanking sequence: TGTGGGAGACGACGATCTCCGCATGGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1260 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCCACGAATAACGTTCTCAACATCTCC ; Right flanking sequence: cgtggaacaccctttttaatctttaaactt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: atttcaataatctCTAATCACTTTCTGATG ; Right flanking sequence: tgtgtaggcatcttatttcaaggaaacaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCTCGACGTCGAGTTTCGATCCGAGAATG ; Right flanking sequence: CCATttctgtaagaatttattgaattttga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 10676 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaattttgtgggaataaacgcacaccgcga ; Right flanking sequence: caaggtgaaaaagaaaacaaatagttactg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous lethal, heterozygous animals might grow slower than wild-type. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type mKate2+GFP+, and segregate wild-type mKate2+GFP+, arrested GFP+ non-mKate2 (rpl-4 homozygotes), arrested non-GFP mKate2+ (hT1 homozygotes), and dead eggs. Maintain by picking wild-type mKate2+ and GFP+. Left flanking Sequence: ATTTCTTCACGTTGGCCTTTGAAGCCTTGC ; Right flanking sequence: Ttattacctgcaatcaacagaaatagtaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2168 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: GTTTCACAAAATGAATAAATTGAGCGATAG ; Right flanking sequence: TGATGCCTGTGATGTGTTGAGTAATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Unbalanced heterozygote. Homozygous lethal, arrests at late larval stage with a few escapers that become sterile adults. Pick viable fertile GFP+ animals to maintain. Deletion of 1032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ACTGGTGCTCGTAAGCACTCGTGGAGTCCG ; Right flanking sequence: TGTTCAAATCGAAAAGCGACGAGTTGCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C01G6.5. Homozygous viable, Egl. Deletion of 3209 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ttccacataagatcttaaaatacagaaata ; Right flanking sequence: ggtgggaaaaacagaagaaaagcatgtcgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: CCGAGTCCCCGTGAGCTCTCGAATCCCGTA ; Right flanking sequence: atgggttactgtagcgcttgtatcgattta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Severely Unc. CRISPR-generated deletion removes 111 bp (ACGATAAGAAAACTA...ATGAATCCGCCCAAG). hrt2 allele is specific to the AO13 unc-44 isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

CRISPR/Cas9-engineered insertion of GFP tag into the large AO13 splice isoform of the endogenous unc-44 locus at amino acid 6303. Slightly reduced body bends while crawling. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtSi41 [des-2p::unc-33L::GFP + unc-119(+)] I. hrtSi41 inserted into ttTi4348. UNC-33L::GFP expression in PVD and FLP. Functional UNC-33::GFP fusion with internal GFP tag inserted at the start of the S isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

C-terminal GFP tag inserted into endogenous unc-119 locus. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtSi69 [des-2p::GFP::unc-33s + unc-119(+)] I. hrtSi69 inserted into ttTi4348. GFP::UNC-33S expression in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtEx161 [des-2p::PA-GFP::tba-1 + des-2p::mKate2 + unc-119(+) + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. PA-GFP::TBA-1 expression in PVD and FLP; fluorescence can be induced illumination by blue light. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

qxIs750 [hsp-16.2p::nuc-1::pHTomato::unc-54 3'UTR + hsp-16.41p::nuc-1::pHTomato::unc-54 3'UTR + odr-1p::GFP]. Heat-shock inducible pHTomato transgene for monitoring lysosomal activity. Reference: Sun Y, et al. Elife. 2020 Jun 2:9:e55745. doi: 10.7554/eLife.55745. PMID: 32482227.