| AH1747 |
C. elegans |
unc-119(ed3) III; zhIs35 I. Show Description
zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
|
|
| AH1779 |
C. elegans |
unc-119(ed3) III; zhIs38 IV. Show Description
zhIs38 [let-23::GFP + unc-119(+)] IV. zhIs38 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene is expressed at levels similar to endogenous LET-23. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
|
|
| PS1411 |
C. elegans |
let-23(sy1) II; sli-1(sy143) X. Show Description
sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS21 |
C. elegans |
let-23(sy1) II; him-5(e1490) V. Show Description
Viable allele of let-23. Vul. Throws males. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS632 |
C. elegans |
unc-101(sy161) I; let-23(sy1) II. Show Description
Grows slowly with low brood numbers. Sluggish worms. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS79 |
C. elegans |
dpy-10(e128) let-23(sy1) II. Show Description
Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS80 |
C. elegans |
let-23(sy1) unc-4(e120) II. Show Description
Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| AML597 |
C. elegans |
lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML614 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx535. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc-
47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML617 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx538. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML618 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx539. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML622 |
C. elegans |
lgc-47(sy1501) X; wtfIs46; wtfEx543. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA,
and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
|
|
| AML659 |
C. elegans |
acc-1(tm3268) IV; lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. mec-4 promoter drives expression of activating opsin molecule Chrimson and fluorescent protein mCherry in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. (2024) iScience. https://www.sciencedirect.com/science/article/pii/S2589004224020017 PMID: 38585821.
|
|
| BC11520 |
C. elegans |
dpy-5(e907) I; sIs10358. Show Description
sIs10358 [rCesY102A11A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC11566 |
C. elegans |
dpy-5(e907) I; sEx11566. Show Description
sEx11566 [rCesY19D10A.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC11990 |
C. elegans |
dpy-5(e907) I; sEx11990. Show Description
sEx11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12786 |
C. elegans |
dpy-5(e907) I; sIs11990. Show Description
sIs11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC12927 |
C. elegans |
dpy-5(e907) I; sIs12803. Show Description
sIs12803 [rCesY18D10A.6a::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13336 |
C. elegans |
dpy-5(e907) I; sIs13113. Show Description
sIs13113 [rCesY110A7A.20::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13672 |
C. elegans |
dpy-5(e907) I; sEx13672. Show Description
sEx13672 [rCesY105E8A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC13865 |
C. elegans |
dpy-5(e907) I; sEx13865. Show Description
sEx13865 [rCesY17G9B.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14121 |
C. elegans |
dpy-5(e907) I; sEx14121. Show Description
sEx14121[rCesY116A8C.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14395 |
C. elegans |
dpy-5(e907) I; sEx14395. Show Description
sEx14395 [rCesY17G7B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC14685 |
C. elegans |
dpy-5(e907) I; sEx14685. Show Description
sEx14685 [rCesY110A7A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15005 |
C. elegans |
dpy-5(e907) I; sEx15005. Show Description
sEx15005 [rCesY111B2A.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC15356 |
C. elegans |
dpy-5(e907) I; sEx15356. Show Description
sEx15356 [rCesY110A2AL.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC16336 |
C. elegans |
dpy-5(e907) I; sEx16336. Show Description
sEx16336 [rCesY116A8C.35::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| MH351 |
C. elegans |
let-60(sy101sy127)/dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys and lethals.
|
|
| PS1009 |
C. elegans |
unc-101(sy237) I; sli-1(sy143) X. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS1258 |
C. elegans |
sli-1(sy129) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS1410 |
C. elegans |
let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS1423 |
C. elegans |
let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS2286 |
C. elegans |
unc-38(x20) lfe-2(sy326) I. Show Description
Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS2366 |
C. elegans |
itr-1(sy328) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS2368 |
C. elegans |
itr-1(sy327) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS2512 |
C. elegans |
itr-1(sy331) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS2516 |
C. elegans |
itr-1(sy291) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS2582 |
C. elegans |
itr-1(sy290) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS2728 |
C. elegans |
sli-1(sy143) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS302 |
C. elegans |
let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS468 |
C. elegans |
let-60(sy100) dpy-20(e1282)/let-60(n1046) unc-22(s7) IV; him-5(e1490) V. Show Description
Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS5131 |
C. elegans |
let-23(sy12)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are GFP+. mIn1 homozygotes are Dpy and GFP+. let-23(sy12) homozygotes are non-GFP. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS524 |
C. elegans |
let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS529 |
C. elegans |
unc-101(sy108) I. Show Description
Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS611 |
C. elegans |
mab-21(sy155) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS746 |
C. elegans |
let-23(sy97) II; sli-1(sy143) X. Show Description
sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS7731 |
C. elegans |
K03E5.2(sy1082) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT;
right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG
Reference: Wang H, et al. G3 (Bethesda).
|
|
| PS7734 |
C. elegans |
T05C3.2(sy1080) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA
Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC
inserted sequence between the two flanking sequence (STOP-In casette):
GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS7778 |
C. elegans |
clik-1(sy1084) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6)
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG;
right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
| PS7783 |
C. elegans |
K03E5.2(sy1086) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG
Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|