Search Strains

mir-253 and part of F44E7.5 are deleted in nDf64. Deletion breakpoints are:GATATCCTCACACTTTGGCAAAGAGTGCTT / GTTGAAGACGGTGAAAACATCCGAATTTTCAGGGAAGTT...TGAGATAAGAACACAAA GAATTCGATTTTC / GTGAATTCTGAACGAAACTTTACGTTTTGGACAGTAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints for n4606 are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Deletion breakpoints for n4570 are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TCTACCGAACTTCGCATAAT / TTCCAATTTTCAATTTCCA...ACAATTTGAAAATAAAAA / TTTGCAGAAAAAGTTGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are: TATTTGCCAAAAATGGAAATTTT / CGGCAAATCGGGAAGCC...AGCTCGTCGGAAGCAATTG / GCTCCGCGTAATTGGAGCCCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements).

Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.

mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73.

Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion covering bases 34070-36042 on T24D8. This is a complete deletion of mir-75, which is on T24D8 (34374-34395).

Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]

Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

nSi3 [set-17p::set-17(+)::GFP::set-17 3’UTR + unc-119(+)] IV. nSi3 expresses a translational fusion of genomic set-17 and GFP. nSi3 rescues the brood size defect of n5017 in this strain. nSi3 is a single copy MOS-mediated transposition into the cxTi10882 site; GFP detectable in the nuclei of the hypoderm, sperm and proximal germline, as well as some other cells. Reference: Engert CG, et al. PLoS Genet. 2018 Apr 27;14(4):e1007295.

Egl. [10/02: This strain was previously listed as being sel-10(n1069) or egl-41(n1069); these were found to be incorrect and the mutation is now called egl-1(n4065). H. Schwartz comm.]

Very mildly Dpy Tc1-induced dpy-19 allele. Generates severe Dpys when Tc1 hops out of dpy-19 (doesn't excise cleanly). See also WBPaper00001672. [Some concern whether the Mut phenotype in this strain is actually mut-2 because it showed no transposition of Tc3 or other Tc's besides Tc1. 1/95.]

Vulvaless. Isolated in lin-8(n111); this strain may still contain n111.

Temperature sensitive. About 50% HSN missing. Mab confirmed by Hillel Schwartz 12/5/00. Rec'd new stock from Horvitz lab 12/2000. [NOTE: The genotype of this strain was incorrectly described as carrying mab-5(mu114); however, the actual allele is mab-5(mu14).]

[egl mutation (n1397) has been removed in this strain.]

C. elegans var Bristol. Generation time is about 3 days. Brood size is about 350. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: This stock might carry a ~1.8 kb deletion in alh-2 in the background. (UPDATE: 03/26/2018 - a user reported the stock they received was homozygous for the alh-2(ot588) mutation.)]

WT C. elegans. From Cambridge collection-originally frozen around 1968: In 1980, in order to establish an ancestral stock, Jonathan Hodgkin thawed one of the earliest frozen tubes of N2, dating from 1968. From this plate J.H. grew up a population en masse (without subculturing) on NGM plates (about 2 generations). Multiple samples of this were frozen in order to provide a reference N2 stock. This set of stock samples was replenished by regrowth in 1985 and 1991, using the same procedure, and a freshly thawed sample was sent to the CGC in 1993. Thus, samples from this frozen stock, called N2 (ancestral), should be only about 6 generations away from the stock used by Sydney Brenner as his standard WT N2. [Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966.] Caenorhabditis elegans wild isolate. Note: N2 (ancestral) has reduced lifespan and fertility relative to the standard CGC N2 strains. See Worm Breeder's Gazette 16(5): 24 (February 1,2001).

C. elegans var Bristol. Self-fertilizing hermaphrodite. Generation time is about 3.5 days at 20C. Male stock maintained by mating. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: (09/07/2018) The Gems Lab has identified a mutation in the gene fln-2 carried in this stock causing an increased lifespan. The effect is quite modest (+11%, median lifespan), but this effect can be more pronounced in other genetic backgrounds.] [NOTE: (03/26/2018) - a user reported the stock they received was homozygous wild-type for alh-2; some N2 stocks carry the ot588 mutation in alh-2.)

Bacteria. Jim Lewis received this E. coli strain from Henry Epstein in 1977. It is a prototroph and the worms grow well on it in liquid, even when the bacteria are highly labeled with 35-S. It hasn't been tested to see if it is temperature sensitive. It should be distributed as "Jim Lewis' NA22" until it has been confirmed that this is a certified version of NA22. Biosafety Level: BSL-1. Grow on NGM.

No obvious phenotype. 2 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Deletion removes all 4 transmembrane domains. This is likely a null allele. Left breakpoint sequence (includes repeated sequence): TTTTTAATTATCCGTAATTTTTTAATTATCCGTAAT. Right breakpoint sequence: AACATCTTTAATCGATTTAT.

otIs181[dat-1::mCherry + ttx-3::mCherry] III. otIs138[ser-2(prom3)::GFP + rol-6(su1006)] X. otIs396 [ace-1(prom2)::NLS::tagRFP]. Rollers. dat-1::mCherry labels ADE, CEP, and PDE neurons. ttx3::mCherry labels AIY neurons. ser-2(prom3)::GFP labels OLL, PDE, and PVD neurons. ace-1(prom2)::NLS::tagRFP labels CEP and OLL neurons. PVD can be identified by expression only GFP. An additional pair of GFP-only cells anterior to OLL are occasionally observed in this strain. Can be used to isolate PVD by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). Reference: Barbara O’Brien (2017) Diverse genetic and transcriptional programs mediate dendritic development of a nociceptor neuron. Ph.D Dissertation, Vanderbilt University. (https://ir.vanderbilt.edu/handle/1803/14489?show=full)

Heterozgyotes are WT and segregate WT, Dpys and Uncs. Recombination occurs in this strain so pick individual WT animals and score the progeny for both Dpys and Uncs.

Excretory canal defect. Large fluid-filled cysts appear randomly along the excretory canal, especially at the tips: 100% penetrant. Cysts often visible as clear spots by low-power microscopy. Shortened canals. Smaller cysts in amphid sheath. Stop mutation in 2nd Ras-like IRGP domain. Encodes homologue of human IRGC. [NOTE (08/2025): The correct genotype of this strain is exc-1(rh26), not exc-3(rh26) as previously described.]

nicTi600 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi556]] I. Maintain at 20C, somewhat sick at 25C. Unc. nicTi600 is a modified version of oxTi556 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi601 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi726]] II. Maintain at 20C, somewhat sick at 25C. Unc. nicTi601 is a modified version of oxTi726 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi602 [eft-3p::tdTomato::H2B::unc-119(-)[*oxTi392]] V. Maintain at 20C, somewhat sick at 25C. Unc. nicTi602 is a modified version of oxTi392 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi603 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi705]] IV. Maintain at 20C, somewhat sick at 25C. Unc. nicTi603 is a modified version of oxTi705 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi604[eft-3p::tdTomato::H2B::unc-119(-) [*oxTi400]] X. Maintain at 20C, somewhat sick at 25C. Unc. nicTi604 is a modified version of oxTi400 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi605 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi612]] III. Broad, nuclear red fluorescence. Unc. Maintain at 20C, somewhat sick at 25C. Unc. nicTi605 is a modified version of oxTi612 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi606 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi391]] IV. Maintain at 20C, somewhat sick at 25C. Unc. nicTiX606 is a modified version of oxTi391 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

pgp-3 deletion allele. No visible phenotype. Drug sensitive (colchicine, chloroquine). Throws males: outcrossed with him-8(e1489) so probably contains this mutation.

ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557.

pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene.