| PS746 |
C. elegans |
let-23(sy97) II; sli-1(sy143) X. Show Description
sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS79 |
C. elegans |
dpy-10(e128) let-23(sy1) II. Show Description
Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS7911 |
C. elegans |
C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2.
lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG;
right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
| PS80 |
C. elegans |
let-23(sy1) unc-4(e120) II. Show Description
Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS9357 |
C. briggsae |
Cbr-unc-4(sy5341) II. Show Description
Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS9538 |
C. elegans |
syIs824. Show Description
syIs824 [15xUAS::Chrimson::tdTomato::let-858 3'UTR + myo-2p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. [NOTE: due to an error in the information submitted to the CGC, this strain was previously described as carrying the array syIs803 with a ttx-3::RFP co-injection marker. The correct name for the array is syIs824 and it carries the myo-2p::GFP marker.]
|
|
| PS968 |
C. elegans |
unc-101(sy216)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS976 |
C. elegans |
lin-48(sy234) III; him-5(e1490) V. Show Description
Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS99 |
C. elegans |
dpy-20(e1362) IV. Show Description
Severe Dpy. Cold sensitive: grow at 20C. Can be used for microinjection because rescued animals are easier to pick out than dpy-20(e1282) rescued animals. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PW20 |
Escherichia coli |
E. coli. Show Description
Bacteria. E. coli harboring the plasmid PB255, which uses the lin-31 promoter variant to express the lin-31::VP16 chimeric gene. It is particularly useful for the expression of heterologous genes in the vulval precursor cells. PB255 possesses three main components : an enhancer, a promoter region, a multi-cloning site (MCS), and a 3' UTR derived from the unc-54 gene. [CGC note: The plasmid in this strain was constructed from pBS II KS(+) and is likely Amp-R, but Amp-R has not been confirmed]. Biosafety Level: BSL-1.
|
|
| PX506 |
C. remanei |
C. remanei wild isolate. Show Description
Male-female strain. Reference strain for the new chromosome-level assembly of the C. remanei genome. This is a natural isolate (BioProject PRJNA577507) inbred to reduce heterozygosity. Reference: https://www.biorxiv.org/content/10.1101/797035v1 (Accepted at Genetics).
|
|
| PX623 |
C. elegans |
fxDf1 II; him-5(e1490) V. Show Description
fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.
|
|
| PY12101 |
C.elegans |
oyIs96. Show Description
oyIs96 [gcy-8p::FlincG3 gcy-8p::myr::TagRFP + unc-122p::dsRed]. Red fluorescence in coelomocytes and faint green fluorescence in AFD head neurons. cGMP fluorescent sensor (FlincG3) expression in AFD neurons allows visualization of AFD signaling. Generated in N2 background. Reference: Extrachromosomal array used in the generation of this strain detailed in https://doi.org/10.1534/genetics.119.302392.
|
|
| PY7502 |
C. elegans |
oyIs85. Show Description
oyIs85 [ceh-36p::TU#813 + ceh-36p::TU#814 + srtx-1p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the ceh-36 promoter. AWC ablated in this strain. Defective thermotaxis. Expression of dsRed in coelomocytes. GFP expression in AFD. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27.
|
|
| PY7505 |
C. elegans |
oyIs84. Show Description
oyIs84 [gpa-4p::TU#813 + gcy-27p::TU#814 + gcy-27p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gpa-4 promoter and gcy-27 promoter, respectively. ASI is ablated in this strain. Increased dauer formation. Expression of dsRed in coelomocytes. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27.
|
|
| QC114 |
C. elegans |
etEx2. Show Description
etEx2 [glo-1p::GFP::ras-2 CAAX + rol-6(su1006)]. Rollers. Pick Rollers to maintain. etEx2 contains plasmid pQC09.6, which carries the ras-2 CAAX motif at the C-terminus of GFP; this array is a prenylation reporter. Reference: Mörck C, et al. Proc Natl Acad Sci U S A. 2009 Oct 27;106(43):18285-90.
|
|
| QC134 |
C. elegans |
nduf-7(et19) I; zcIs9 V. Show Description
zcIs9 [hsp-60::GFP + lin-15(+)]. Constitutively activated mitochondrial UPR and an extended lifespan. [NOTE: This strains was previously described as only nduf-7(et19). It is in fact carrying the zcIs9 transgene.] Reference: Rauthan M, et al. G3 (Bethesda). 2015 Jun 1. pii: g3.115.018598.
|
|
| QC154 |
C. elegans |
paqr-2(tm3410) III; paqr-1(tm3262) IV. Show Description
This double mutant strain has a severely deformed tail tip and is intolerant of cold (will not grow then die at 15°C) and of dietary saturated fatty acids. Its cell membranes are rigid and rich in saturated fatty acids, and the strain has a small brood size, slow locomotion, permeable cells, autophagy defects as well as other phenotypes. References: Svensson E, et al. PLoS ONE 6(6):e21343. PMID: 21712952. Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
| QC155 |
C. elegans |
nhr-49(et8) I; mdt-15(et14) III. Show Description
This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
| QC156 |
C. elegans |
acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. Show Description
This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
| QC158 |
C. elegans |
paqr-1(et52) IV. Show Description
paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056
|
|
| QC162 |
C. elegans |
fat-2(wa17) IV; egl-9(et60) V. Show Description
egl-9(et60) is a 1670G>A (Arg557His) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC165 |
C. elegans |
fat-2(et63wa17) IV. Show Description
fat-2(et63) is a 73G>A (Val25Met) substitution mutation and intragenic fat-2(wa17) suppressor. This strain still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC166 |
C. elegans |
fat-2(et64wa17) IV. Show Description
fat-2(et64) is a 296C>T (Ser99Leu) substitution and intragenic fat-2(wa17) suppressor. This allele still carries the fat-2(wa17) S101F substitution mutation. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.
|
|
| QC82 |
C. elegans |
etEx1. Show Description
etEx1 [rol-6(su1006) + W02H5.8(2kb)::GFP]. Pick Rollers to maintain. 2 kb fragment of W02H5.8 was cloned intoFire Lab vector pPD95.69. This strain has been used by the Worm Atlas to study the development of the intestine.
|
|
| QK52 |
C. elegans |
rde-1(ne219) V; xkIs99. Show Description
xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66.
|
|
| QX1182 |
C. sp. 8 |
Show Description
Male-female strain. Isolated by M. Rockman from rotting tomatoes in New Jersey, USA, July 2007. NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.
|
|
| RAF2181 |
C. elegans |
ieSi57 II; daf-2(bch-40[AID*::3xFLAG::STOP::SL2::SV40::AID*::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
|
|
| RB1000 |
C. elegans |
gcy-5(ok921) II. Show Description
ZK970.6 Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 1545 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1001 |
C. elegans |
C01F6.1(ok922) IV. Show Description
C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1002 |
C. elegans |
T19D2.1(ok923) X. Show Description
T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1003 |
C. elegans |
aco-1(ok924) X. Show Description
ZK455.1. Previously called gei-22. Homozygous. Outer Left Sequence: CACACACAAAAACGGACAGG. Outer Right Sequence: TCGTTGCTCCAAATCACAAA. Inner Left Sequence: AGACGAGCTTCCAATCTCCA. Inner Right Sequence: TTCCTCCGTTGCGGTAATAG. Inner Primer WT PCR product: 2984. Deletion size: 540 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1004 |
C. elegans |
K08E3.4(ok925). Show Description
K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1005 |
C. elegans |
R02D3.1(ok926) IV. Show Description
R02D3.1. Homozygous. Outer Left Sequence: TGTTCAAGCGTAACACGACC. Outer Right Sequence: AAACCATTTGGATTGCCGTA. Inner Left Sequence: CAGATGTCTGCCGCTGTAAC. Inner Right Sequence: TTCAACACAACCAAATCCGA. Inner Primer WT PCR product: 3055. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1006 |
C. elegans |
C08B6.4(ok890) V. Show Description
C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1007 |
C. elegans |
C16C10.12(ok927) III. Show Description
C16C10.12. Homozygous. Outer Left Sequence: GAGAAAGTGAGCTCCGCAAT. Outer Right Sequence: GCCTACAAAAATGCCATTCG. Inner Left Sequence: ATCACATCGAGGCAAGCTCT. Inner Right Sequence: CAATCGATACAAGCAGCCAA. Inner Primer WT PCR Product: 2693. Deletion size: 635 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1008 |
C. elegans |
cri-2(ok928) V. Show Description
K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1009 |
C. elegans |
Y48C3A.14(ok929) II. Show Description
Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1010 |
C. elegans |
gcy-5(ok930) II. Show Description
ZK970.6. Homozygous. Outer Left Sequence: CGGTGTCATTTCAGAGAGCA. Outer Right Sequence: GTTGAGGCAACCTTAAGCGA. Inner Left Sequence: TTGCTCAGCTTTTGGCCTAT. Inner Right Sequence: AGTGCGGATTGTCTGGAAAG. Inner Primer WT PCR Product: 3316. Deletion size: 2542 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1011 |
C. elegans |
crb-1(ok931) X. Show Description
F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1012 |
C. elegans |
egl-8(ok934) V. Show Description
B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1013 |
C. elegans |
pax-2(ok935) IV. Show Description
K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 1620 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1015 |
C. elegans |
nhr-66(ok940). Show Description
T09A12.4. Homozygous. Outer Left Sequence: GGTATCTGCCTTGTTCTGCC. Outer Right Sequence: GAAACGATGCTCATGCTCAA. Inner Left Sequence: AACCGCGAACAACGAGTTAC. Inner Right Sequence: CAGGGGAACCGCTAGACATA. Inner Primer WT PCR product: 3091. Deletion size: 1317 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1017 |
C. elegans |
nab-1(ok943). Show Description
C43E11.6. Homozygous. Outer Left Sequence: ATCGCAATTTTCTCCATTCG. Outer Right Sequence: GCGTACTTCTTTCGGAGTGG. Inner Left Sequence: TATTCCGATTCCACACAGCA. Inner Right Sequence: CGATGCGTCAATTTATGTGG. Inner Primer WT PCR Product: 3254. Deletion size: 1032 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1018 |
C. elegans |
cgr-1(ok944) X. Show Description
T27A10.7. Homozygous. Outer Left Sequence: TCCATGCGAATTGTTGAAAA. Outer Right Sequence: ATCCGCATCTGAATGAGCTT. Inner Left Sequence: TGTCTCCACTGCTAACACGC. Inner Right Sequence: CCGCCCATCAAAAAGATAAA. Inner Primer WT PCR product: 2628. Deletion size: 1242 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1019 |
C. elegans |
pax-2(ok946) IV. Show Description
K06B9.5. Homozygous. Outer Left Sequence: GGGCAGAACACGAATTTTTC. Outer Right Sequence: GCACATCCCTGGTTGAAACT. Inner Left Sequence: CGCAAATTTGGTCCTGAAAT. Inner Right Sequence: CTCCGCCTACTGTTAGCTCG. Inner Primer WT PCR product: 2959. Deletion size: 712 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1020 |
C. elegans |
C26D10.4(ok947) II. Show Description
C26D10.4. Homozygous. Outer Left Sequence: GTTACTGAATTGCCGTGCCT. Outer Right Sequence: CAAAAGTGTACCGCTGGGTT. Inner Left Sequence: AAAAATCACGAGATTCCGCA. Inner Right Sequence: CATCATCATTGATCGCTTGG. Inner Primer WT PCR Product: 3275. Deletion size: 1473 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1021 |
C. elegans |
crt-1(ok948) V. Show Description
Y38A10A.5. Homozygous. Outer Left Sequence: TATGGCACTTCGTCAGATGG. Outer Right Sequence: CATTGTCGTAGCAGACGAGC. Inner Left Sequence: TGTCGAGAGGAATCGATGTG. Inner Right Sequence: TTTGCTCTTGTTCGGTTTCA. Inner Primer WT PCR product: 2134. Deletion size: 1287 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1022 |
C. elegans |
R11A5.2(ok949) I. Show Description
R11A5.2. Homozygous. Outer Left Sequence: AATGCTGGCGTTCTCTGTCT. Outer Right Sequence: TGCTGCCTATCGTGAGTTTG. Inner Left Sequence: TGAAATGGAGGATCCCTGAG. Inner Right Sequence: ATTTCGTGTGGGAAATTGGA. Inner Primer WT PCR product: 2183. Deletion size: 1109 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1023 |
C. elegans |
C49C8.4(ok950) IV. Show Description
C49C8.4. Homozygous. Outer Left Sequence: CCCCTTGTGCTACGAAAAGA. Outer Right Sequence: CTCCCTTTTCTGACCTGCTG. Inner Left Sequence: AGGTTACGGTATCGGTGCTG. Inner Right Sequence: TTCACTGGCGTGTATTTTGG. Inner Primer WT PCR product: 2871. Deletion size: 1439 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|