| IK800 |
C. elegans |
gcy-8(oy44) IV. Show Description
Nearly normal thermotaxis behavior.
|
|
| IT1187 |
C. elegans |
unc-119(ed3) III; kpIs100. Show Description
kpIs100 [pie-1p::Ub(G76V)::GFP::H2B::drp-1 3' UTR + unc-119(+)]. [NOTE: (4/4/2025): Strain segregates Rol, and non-Rol, possibly due to a background dpy-10 mutation; both express GFP as expected. It was recommended that non-Rollers be picked when maintaining the strain.] Expresses Ubiquitin::GFP fusion protein in the germ line. The last amino acid of ubiquitin is mutated to valine (G76V), which prevents the cleavage of ubiquitin from GFP by the deubiqutinating enzymes and renders the GFP constitutively targeted for degradation by the proteasome. The strain can be used to assay proteasome activity in the germ line. Reference: Kumar GA & Subramaniam K. Development. 2018 Mar 29;145(7):dev163949. PMID: 29540500
|
|
| IW412 |
C. elegans |
tax-2(gk117937) I. Show Description
Maintain at 20C. Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151
|
|
| IW465 |
C. elegans |
tax-2(iw80) I. Show Description
Improvement in thermotolerance at 37C, though weaker than in null mutants. Longer lifespan than to tax-2(gk117937) null mutant. Higher frequency of dauer formation and survival at 28C than tax-2(gk117937) null mutant. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151
|
|
| JC2154 |
C. elegans |
hen-1(tm501) X. Show Description
Hesitation in crossing an aversive ion. Defective in behavioral plasticity after conditioned with NaCl and starvation or with temperature and starvation.
|
|
| JCB418 |
C. elegans |
Y67H2A.2(bet63) IV. Show Description
Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.
|
|
| JCB419 |
C. elegans |
Y76A2B.4(bet65) III. Show Description
Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.
|
|
| JCB426 |
C. elegans |
chil-11(bet66) IV. Show Description
Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.
|
|
| JCB434 |
C. elegans |
K04C2.8(bet68) III. Show Description
Homozygous viable. Deletion of 796 bp in parental strain N2, with insertion of 13 nucleotides(tcaacaaaatgcc) at break. Left flanking sequence: taatatcctccggaccgata; Right flanking sequence: gtcctgactgataatcatcaac. sgRNA #1: tgtgtagtataaacgattat; sgRNA #2: cgggtcacgagtagagatgg.
|
|
| JCB435 |
C. elegans |
C14B1.9(bet70) III. Show Description
Homozygous viable. Deletion of 973 bp in parental strain N2. Left flanking sequence: aaactacggtaacacccatt; Right flanking sequence: tgacggatgcaatgacaaga. sgRNA #1: gagacctacacatgccaaat; sgRNA #2: tttggattaatgttacctga.
|
|
| JCB455 |
C. elegans |
K02D10.3(bet75) III. Show Description
Homozygous viable. Deletion of 247 bp in parental strain N2.Deletion appears to have occurred at the sgRNA #2 cut site. Left flanking sequence: tttataggaatttcaggaat; Right flanking sequence: ttccgtcaccttccgtcaaa. sgRNA #1: aaatgataagaagccaaagc; sgRNA #2: tttgtgtttatgacgagctc.
|
|
| JCB458 |
C. elegans |
T19C4.5(bet77) V. Show Description
Homozygous viable. Deletion of 1581 bp in parental strain N2. Also contains a SNP (A->T) in right flanking sequence (uppercase text). Left flanking sequence: ctactcatgatataccttct; Right flanking sequence: ccggTgctctcttgttgtct. sgRNA #1: gttttcacatgggcaagaga; sgRNA #2: atttcaattccatttcccac.
|
|
| JCB459 |
C. elegans |
C18E9.4(bet80) II. Show Description
Homozygous viable. Deletion of 492 bp in parental strain N2. Left flanking sequence: agccgtttaagatcccaaac; Right flanking sequence: ggatggtcatcattagaatt. sgRNA #1: ttgctgtagattgagtagtt; sgRNA #2: cacggaaccacctcatggga.
|
|
| JCB461 |
C. elegans |
Y116F11B.14(bet83) V. Show Description
Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.
|
|
| JCB487 |
C. elegans |
K02D10.1(bet88) III. Show Description
Homozygous viable. Deletion of 2796 bp in parental strain N2. Left flanking sequence: tatgaactttaagaccaact; Right flanking sequence: ggatgggatgcaactgttgc. sgRNA #1: actcatactataagttcagt; sgRNA #2: ctacttgggcaaagccagga.
|
|
| JCP152 |
C. elegans |
dpy-11(e224) ccz-1(t2129) V; jcpEx2. Show Description
jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
|
|
| JCP169 |
C. elegans |
dpy-11(e224) ccz-1(t2129) V; jcpEx3. Show Description
jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
|
|
| JCP294 |
C. elegans |
ints-6(t1903) IV. Show Description
Temperature-sensitive. Grows well at 15C; embryonic lethal at 25C. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
| JCP341 |
C.elegans |
jcpSi10 II; unc-119(ed3) III. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
| JCP378 |
C. elegans |
jcpSi19 II; unc-119(ed3) III. Show Description
jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
| JCP383 |
C. elegans |
jcpSi10 II; ints-6(tm1615) IV. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
| JCP462 |
C. elegans |
ints-6(jcp1[ints-6::3xFLAG]) IV. Show Description
3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
| JCP53 |
C. elegans |
dpy-11(e224) ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
|
|
| JD31 |
C. elegans |
glc-4(ok212) II. Show Description
C27H5.8. No obvious phenotype. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| JDW182 |
C. elegans |
bmdSi15 lmn-1(wrd39[lmn-1::1xGFP11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.
|
|
| JDW223 |
C. elegans |
wrdSi35 II. Show Description
wrdSi35 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. [NOTE: The genotype of this strain was previously described as wrdSi51. The correct allele name is wrdSi35.] Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| JDW313 |
C. elegans |
jsSi1579; wrdSi58 II. Show Description
wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
|
|
| JDW324 |
C. elegans |
jsSi1579; wrdSi57 II. Show Description
wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
|
|
| JEK1001 |
C. elegans |
ddx-15 (tm4014) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4014 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The tm4014 allele was provided by the National BioResource Project (NBRP, for C. elegans).
|
|
| JH1270 |
C. elegans |
nos-1(gv5) II. Show Description
No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.
|
|
| JH1473 |
C. elegans |
itIs153; ojIs1. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C. Constructed by crossing heterozygous ojIs1 males into KK866 (itIs153) hermaphrodites and selecting for double homozygosity of the arrays. itIs153 is an integrated derivitive of axEx1094.
|
|
| JH3158 |
C. elegans |
swan-1&swan-2(ax2071) V. Show Description
Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801593-13807217) and insertion of ATTTGTTCAGACAATAAGCTNGAAATC. No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3159 |
C. elegans |
swan-1&swan-2(ax2072) V. Show Description
Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801629-13807223). No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3212 |
C. elegans |
gtbp-1(ax2068) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127256...10128923. Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3215 |
C. elegans |
gtbp-1(ax2073) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
| JH3248 |
C. elegans |
meg-4(ax2081) X. Show Description
Deletion removing 733 base pairs upstream of start and the first 2565 bases of the endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
|
|
| JH3475 |
C. elegans |
meg-3(ax3055) meg-4(ax3052) X. Show Description
Embryonic P granules not segregated, 30% maternal effect sterility on average, RNAi insensitivity. meg-3(ax3055) and meg-4(ax3052) are precise deletions of the entire coding sequence made by CRISPR/Cas9, designed to be cut again to make insertions at the endogenous locus. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
|
|
| JH3553 |
C. elegans |
meg-3(ax4503[del(1-544)::OLLAS]) meg-4(ax4504) X. Show Description
Description: 20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (1-544); MEG-3 does not form a cytoplasmic gradient but does still form granules in early embryos and co-localizes with PGL-3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
| JH3614 |
C. elegans |
par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X. Show Description
meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
|
|
| JH3619 |
C.elegans |
par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
|
|
| JH3679 |
C. elegans |
mex-5(ax3050[mCherry::mex-5]) IV; par-1(ax4206[par-1::meGFP]) V. Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Homozygous mex-5(ax3050[mCherry::mex-5]); par-1(ax4206[par-1::meGFP]) animals are fully viable and fertile. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.
|
|
| JH3861 |
C. elegans |
meg-3(ax4502[meg-3(F705A,Y708A,Y713A, N725A)::OLLAS]) meg-4(ax3052) X. Show Description
20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
| JH4504 |
C. elegans |
glh-1(ax4587[glh-1(del18-236) I. Show Description
ax4587 is a CRISPR-engineered deletion removing the FGG repeats of GLH-1. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
|
|
| JIN1679 |
C. elegans |
jinEx10. Show Description
jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Pick Rollers to maintain. hlh-30::GFP expression should be visible at relatively low magnification. Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.
|
|
| JJ1068 |
C. elegans |
hmp-2(zu364)/hIn1 [unc-54(h1040)] I. Show Description
hmp-2(zu364) homozygotes are 99% embryonic or L1 lethal due to a defect in embryonic body elongation; approximately 1% survive to adult stages. Well balanced by hIn1. Maintain by picking WT.
|
|
| JJ1079 |
C. elegans |
hmr-1(zu389)/lin-11(n566) unc-75(e950) I. Show Description
Heterozygotes are WT and segregate WT, Hmr inviable embyros and Egl Unc. Hmr: Hammerhead - defective hypodermal enclosure, especially in anterior regions; approximately 2% of zu389 embryos enclose normally and are Hmp [Humpback: defective body elongation, abnormal bulges on dorsal side]. See also WBPaper00005031. Received new stock from Allison Lynch in the Hardin lab 3/2009.
|
|
| JJ1237 |
C. elegans |
mex-6(pk440) II. Show Description
Viable, fertile, apparently normal.
|
|
| JJ1508 |
C. elegans |
unc-119(ed3) III; zuIs60. Show Description
zuIs60 [pie-1p::GFP(secreted) + unc-119(+)]. Maternally-expressed secreted GFP fills spaces between embryonic cells, and space between embryo and vitelline membrane. Useful marker for vizualizing intercellular spaces in embryos. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.
|
|
| JJ1550 |
C. elegans |
dpl-1(zu355) unc-4(e120)/rol-6(e187) let-23(sy97) II. Show Description
Heterozygotes are WT and segregate WT, Uncs which give only deads egss with a Mex phenotype, and Vulvaless Rollers. sy97 is only 15% viable.
|
|
| JJ2586 |
C. elegans |
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Show Description
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.
|
|