Strain Information
Name | JCB455 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | K02D10.3(bet75) III. |
Description | Homozygous viable. Deletion of 247 bp in parental strain N2.Deletion appears to have occurred at the sgRNA #2 cut site. Left flanking sequence: tttataggaatttcaggaat; Right flanking sequence: ttccgtcaccttccgtcaaa. sgRNA #1: aaatgataagaagccaaagc; sgRNA #2: tttgtgtttatgacgagctc. |
Mutagen | Crispr/Cas9 |
Outcrossed | x2 |
Made by | Bettinger lab |
Laboratory | JCB |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.