Strain Information
| Name | JCB455 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | K02D10.3(bet75) III. |
| Description | Homozygous viable. Deletion of 247 bp in parental strain N2.Deletion appears to have occurred at the sgRNA #2 cut site. Left flanking sequence: tttataggaatttcaggaat; Right flanking sequence: ttccgtcaccttccgtcaaa. sgRNA #1: aaatgataagaagccaaagc; sgRNA #2: tttgtgtttatgacgagctc. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Bettinger lab |
| Laboratory | JCB |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.