Search Strains

goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs5 [nmr-1p::SL1::GCaMP3.35::SL2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several command interneurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.

goeIs22 [mec-4p::SL1::GCaMP3.35::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several mechanosensitive neurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.

Complete lack of behavioral quiescence during sleep. References: Turek et al. Current Biology, 2013, 23, 2215-2223. Turek et al. eLife 2016;5:e12499.

Complete lack of behavioral quiescence during sleep. Reference: Turek et al. Current Biology, 2013, 23, 2215-2223.

70% reduction of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.

Complete lack of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.

Temperature sensitive embryonic lethal mutation with defects in centration and rotation of the centrosome pronuclear complex in the first cell division. Maintain at 15C.

hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

Slow moving Unc. Semi-dominant. Body muscle abnormal. Slightly small.

Slow moving Unc. Body muscle abnormal. Slightly small.

HG231 exhibits an approximately 20% increase in mean, median and maxium lifespans compared to N2. HG231 exhibits somewhat reduced fertility and somewhat longer development time than N2. It has a normal appearance, movements and mating behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.

Heterozygtes are WT. Hets segregate WT, UncBli and DpyLet. ct42 homozygotes are inviable at all temperatures (recessive non-conditional larval lethal). ct42 is dominant temperature sensitive maternal effect lethal. ct42 hets give more inviable progeny at 25C than at 15C. dch-1 was previously called let-354(ct42).

Heterozygotes are WT and segregate WT and DpySteriles. ct45 homozygotes give only dead eggs at all temperatures. ct45 is ts dominant. Hets give more viable progeny at 15C than 25C.

Dominant ts maternal-effect embryonic lethal. Embryos show extensive cytoplasmic blebbing, often accompanied by small spindles and incomplete cytokinesis. Two cell embryos divide synchronously. Embryos arrest with eight to several hundred cells. Recessive non-ts maternal-effect embryonic lethal. Null may be WT. Maintain at 15C.

Heterozygotes are WT. ct46 is a dominant, temperature sensitive maternal effect lethal. ct46 homozygotes are viable and fertile at 15C. b284 is a non-conditional, recessive maternal effect lethal. Heterozygotes give more viable progeny at 15C than 25C.

Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.

This strain can grow at 11.5C but is embryonic lethal at 15C and above. Temperature shifts in late embryogenesis or in larval stages result in defects in many asymmetric cell divisions in postembryonic develoment.

osIs5 [scm::wrm-1::Venus + unc-76(+)]. WRM-1::GFP localizes to the anterior cortex in the seam cells prior to or during cell division, and to the posterior daughter's nucleus after cell division.

vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3091 homozygotes (Sys Unc Psa). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

zdIs5 [mec-4p::GFP + lin-15(+)] I. Homozygous nT1[qIs51] are inviable. mec-4::GFP is expressed in touch neurons. Heterozygotes are strong Egl Psa GFP+ and segregate dead eggs and non-GFP Unc Egl Psa that give only dead eggs at 25C.

Tail abnormal. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.

Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.

Egl, Pvul, Psa (Phasmid Socket Absent) and some embryonic lethality. The T cell division can be symmetric as in lin-17 mutants. Less severe at 15C. swsn-4 encodes a homolog of yeast SW12, a component of the SWI/SNF complex.

vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok546 homozygotes (Unc Egl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and non-GFP triple homozygotes (mostly Emb with a few animals surviving to early L1). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

Temperature sensitive. At 22.5C, maternal effect embryonic lethal. Temperature shift-up to 22.5C during embryogenesis results in animals with Egl, Pvul and Psa (phasmid socket absent) phenotypes. Shift-up to 25C results in growth arrest at larval stage. The T cell division can be symmetric as in lin-17 mutants. At 15C, nearly WT. Males grown at 15C can mate very well. psa-1 encodes a homolog of yeast SW13, a component of the SWI/SNF complex. Sequence data of this strain revealed the mutation is actually GTC/CCC/TCA to GTC/CTC/TCA causing a P86L substitution (G. Hayes).

Heterozygotes are WT and GFP+. os37 homozygotes are Lvl and Psa. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.

Heterozygotes are WT and GFP+. Segregate GFP- sterile Unc Psa (phasmid socket absent), very rare homozygous hT2 glowing animals, and dead eggs. ceh-20(os39) animals show defects in asymmetric T cell division.

Healthy. Abnormal morphology of the tail (only at Nomarski level). Defects in asymmetric T cell division causes Psa (phasmid socket absent).

Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm514 homozygotes (probable embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain.

Cold sensitive embryonic lethal. 95% viable at 24C, 3.7% viable at 15C. 43% symmetric 2-cell. Osmotically senstive (thus requires lineage in osmotically conditioned media, such as 0.8X egg salt).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-4(or344).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-5(ye121).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 24C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2..

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-6(ye143).

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. apr-1(bp298) is a G338E missense mutation disrupts the normal asymmetric division pattern of seam cells, causing symmetric divisions. Reference: Huang XX, et al. Dev Biol. 2009 Sep 15;333(2):337-47.

WT behavioral phenotype. Axon guidance defect in ceh-17 expressing neurons ALA and 4SIA. ceh-17 = D1007.1, a C. elegans paired homeodomain transcription factor, Phox2 orthologue. np1 is a molecular null. np1 is a 1353 bp deletion inculding 549 bp upstream of the initiator ATG and extending to the 5th codon of the homeodomain. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background, and outcrossing the strain resulted in significantly reduced quiescence during lethargus.]

quEx168 [sax-3::GFP + odr-1::RFP]. Pick RFP+ to maintain. GFP is visible at higher magnification but fades quickly. Strongest GFP is in the head region. The Chin-Sang Lab recommends researchers use this strain instead of IC450, as sax-3::GFP expression in IC699 is more consistent than in the comparable strain IC450.

Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.

frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Constitutive expression of antimicrobial peptide nlp-29. Maintain under normal conditions. Reference: Lee KZ, et al. Virulence. 2010 May-Jun;1(3):113-22.

No phenotype. Contains a 2063 bp deletion in the smf-1 locus (K11G12.4) from position 17016 to position 19079 on the K11G12 cosmid. eh5 was obtained from the Sanger Centre Knockout Service in strain HX104. Reference: Au C, et al. PLoS One. 2009 Nov 18;4(11):e7792.

Nearly normal thermotaxis behavior.

Nearly normal thermotaxis behavior.