Strain Information
Name | JCB461 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | Y116F11B.14(bet83) V. |
Description | Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga. |
Mutagen | Crispr/Cas9 |
Outcrossed | x2 |
Made by | Bettinger lab |
Laboratory | JCB |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.