Strain Information
| Name | JCB434 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | K04C2.8(bet68) III. |
| Description | Homozygous viable. Deletion of 796 bp in parental strain N2, with insertion of 13 nucleotides(tcaacaaaatgcc) at break. Left flanking sequence: taatatcctccggaccgata; Right flanking sequence: gtcctgactgataatcatcaac. sgRNA #1: tgtgtagtataaacgattat; sgRNA #2: cgggtcacgagtagagatgg. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Bettinger lab |
| Laboratory | JCB |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.