Search Strains

Heterozygous animals Roll and have GFP(+) distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes which are sterile and vulvaless. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. q1190 is a deletion in mpk-1 that removes 2221bp between axons 2-7 (based on mpk-1b annotation). Sequence is shared between mpk-1a and mpk-1b. The deletion is in frame and leaves 27bp of coding sequence.Reference: Robinson-Thiewes S, et al. Cell Rep. 2021 May 25;35(8):109162. doi: 10.1016/j.celrep.2021.109162.

Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1054 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.

Pick GFP+ to maintain. CRIPSR-engineered modification of gld-1 FBEa and FBEa* in gld-1 3'UTR.  Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1243 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Increase in distal GLD-1 protein levels and decrease in proximal GLD-1 protein levels. Qiu et al., in preparation.

Pick GFP+ to maintain. C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elementa LBS BCD (Yoo et al., 2004). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1167 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.

Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

Pick GFP+ to maintain. PUF-interacting motif B (PIM B) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1086 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.

Pick GFP+ to maintain. PUF-interacting motif A (PIM A) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1124 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.

Balanced temperature-sensitive allele of glp-1. Maintain at 20-25C. At restrictive temperature (25C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, UncSteriles, and arrested eT1 aneuploid progeny (dead eggs). At permissive temperature (15C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, fertile Unc-32 (can be maintained as a homozygous stock at 15C), and arrested eT1 aneuploid progeny (dead eggs). Maintain by picking wild-type and check for correct segregation of progeny to maintain. eT1 previously known as unc-36(e873). Do not distribute this strain; other labs should request it from the CGC.

Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-1. Do not distribute this strain; other labs should request it from the CGC.

Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-6. Do not distribute this strain; other labs should request it from the CGC.

ZF1-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of zyg-9 protein by providing a source of ZIF-1. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.

ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of air-1 protein by providing a source of ZIF-1. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of par-6 by providing ZIF-1. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437. doi: 10.7554/eLife.64437. PMID: 34137371.

ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of tpxl-1 protein by providing a source of ZIF-1. GFP expression is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.

ZF1-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of gip-1 protein by providing a source of ZIF-1. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF1-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

Phenotypically normal except that it does not show ges-1 activity. Mutations (ca6ca7) are presumably misense or nonsense but have not been characterized genetically.

No obvious phenotype. Chromosomal deletion beginning from -42 bp to +1196 bps relative to elt-4 ATG (+20bp insert).

Partial maternal effect lethal. Lack of PHO-1 acid phosphatase activity on isoelectric focusing gel.

Heterozgyotes are WT and segregate WT, DpyUncs, and Unc Pho (slightly slow growing, about 15% shorter than WT and produce about 60% inviable embryos; early broods are less viable than later broods).

Animals with Dp/+ are WT. Animals which have lost the Dp arrest as L1 with Gob (gut-obstructed) phenotype. Animals with Dp/Dp are sterile homozygotes. gob-1(ca17) is a small deletion, removing nine genes between R03A10.4 and H13N06.4 (inclusive) and possibly the seven additional genes F39D8.2 to R03A10.3 and H13N05.6.

Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

vxEx265 [gcy-8p::ICE + myo-2p:mCherry]. Pick mCherry+ animals to maintain. Expresses human caspase (ICE) to ablate AFD neurons. Reference: Vidal-Gadea AG, et al. Elife. 2015 Jun 17;4. doi: 10.7554/eLife.07493.

vxEx325 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx325 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx325 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx327 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx327 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx327 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx338 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx338 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx338 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx344 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx344 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx344 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx346 [slo-1p::hslo(D362/367A + 5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially resistant to ethanol and crooked neck phenotype. vxEx346 expresses human BK channel protein (hslo(D362/367A + 5D5N)) with compromised calcium-sensing residues and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx350 [slo-1p::slo-1(5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partial crooked neck phenotype. vxEx350 expresses worm BK channel protein (slo-1(5D5N)) with purported calcium-sensing residues in the calcium bowl compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx358 [slo-1p::slo-1(D391/396A + 5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Crooked neck phenotype. vxEx358 expresses worm BK channel protein (slo-1(D391/396A + 5D5N)) with purported calcium-sensing residues compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx360 [slo-1p::slo-1(D391/396A)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially crooked neck phenotype. vxEx360 expresses worm BK channel protein (slo-1(D391/396A)) with purported calcium-sensing residues in the RCK1 domain compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx383 [myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Resistant to the effects of ethanol. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

Resistant to the effects of ethanol on egg-laying and locomotion. Derived by outcrossing Million Mutation Project strain VC40372 and verification that this outcrossed strain retains the slo-1(gk602291) allele and resistance to ethanol. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx105 [dat-1p::ChR2::mCherry + myo-2p::mCherry]. Raise on retinal for optogenetic manipulations (per Vidal-Gadea, 2011). Not necessary for survival. Reference: Vidal-Gadea A, et al. Proc Natl Acad Sci U S A. 2011 Oct 18;108(42):17504-9.

vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Genetic ablation of AFDL, AFDR, FLPL, FLPR, BDUL, and BDUR via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD, FLP, and BDU via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD, FLP, and BDU via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx345 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx345 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx345 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx328 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx328 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx328 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx339 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx339 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx339 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx326 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx326 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx326 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx582 [gcy-8p::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx725 [egl-1p::mCherry::egl-1(G55E, F65D)::egl-1 3'UTR + gcy-32p::GFP::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain. mCherry-tagged EGL-1 visible in URX adult neurons and apoptotic cells. G55E and F65D mutations in the BH3-only region to abolish mCherry::EGL-1 function in inducing cell death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930.

vxSi808 [rab-3p::APP::mCherry::unc-54 3'UTR] X. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Single-copy insertion of human APP transgene tagged with mCherry expressed throughout the nervous system, visible along ventral nerve cord, head, tail, and other neurons. GFP expression in all serotonergic neurons. References: Yi B, et al. 2017 J Neurochem 140(4): 561-575. PMID: 27926996. Mondal et al. 2018 ACS Chem Neurosci. DOI: 10.1021/acschemneuro.7b00428 PMID: 29426225

vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgene driving expression of human APOE4 throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in up to 60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938

vxIs823 [rab-3p::APP::mCherry::unc-54 3'UTR] II. vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgenes driving expression of human APOE4 and human APP throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in >60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938

wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. ajm-1 previously called jam-1.