Strain Information
Name | JCB418 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | Y67H2A.2(bet63) IV. |
Description | Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat. |
Mutagen | Crispr/Cas9 |
Outcrossed | x2 |
Made by | Bettinger lab |
Laboratory | JCB |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.