shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.

shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686.

Temperature sensitive. 8% of total oocytes produced are fertilized and give rise to larvae at 16C. Almost completely sterile at 25C.

sEx13840 [rCes Y119D3B.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Heterozygotes are fertile and grow more slowly than gld-1(q266) homozygotes. gld-1(q266) homozygotes are sterile and produce small abnormal oocytes. nDf24 homozygotes are dead.

Heterozygotes are WT and segregate WT, Steriles (hd43 homozygotes) and Dpy Uncs.

Reduced fatty acid elongation.

Hermaphrodites have abnormal truncated or blebbed tails, pale appearance, some excretory cell abnormalities, especially in adults. Males have variably abnormal tails, some are able to mate.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

T2A::sGFP2(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates sGFP2(1-10) from GLH-1 post-translationally so that sGFP2(1-10) disperses throughout germ cell nuclei and cytoplasm. sGFP2(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 16aa GFP11 or M3 sequence will bind sGFP2(1-10) in the germline and early embryo to emit GFP fluorescence. Broods from DUP223 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. [NOTE: (04/23/2021) The original stock received by the CGC was found to be carrying a second insertion, clu-1(sam131[GFP(11)::clu-1]. A new stock verified by to be carrying the correct transgene was received from DUP 05/04/2021.] Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 18aa wrmScarlet(11) sequence will bind wrmScarlet(1-10) in the germline and early embryo to emit wrmScarlet fluorescence. Broods from DUP237 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

Gain of function allele of mdt-15. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.

mgIs73 [cyp-14A4p::gfp::cyp-14A4 3’UTR + myo-2p::mCherry] V. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.

mgIs73 [cyp-14A4p::GFP::cyp-14A4 3’UTR + myo-2p::mCherry] V. Slow growth. Low brood size. Received as a replacement for GR2249. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.

Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.

Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.

Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs (0.5% leaky). Maintain by picking WT. Not a strict maternal effect.

Double mutant is less sensitive to ionizing radiation than the parg-2(ok980) single mutant, but as sensitive as the exo-1(tm1842) single mutant. Parental parg-2(ok980) strain outcrossed 6 times; parental exo-1(tm1842) strain outcrossed 4 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.

GFP inserted at N-terminus of endogenous vha-13 locus. GFP expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.

wrmScarlet inserted at N-terminus of endogenous vha-13 locus. wrmScarlet expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.

syIs300 [15xUAS::(delta)pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector.  Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs301 [myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs302 [15xUAS::?pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  nlp-40 cGAL driver for intestine.  NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III.  nlp-40 cGAL driver for the intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs320 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V.  nlp-40 cGAL driver for intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  myo-3 cGAL driver for body wall muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + pBluescript].  GFP cGAL effector.  Weak background fluorescence in some head neurons and the head mesodermal cell.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs341 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs342 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs373 [15xUAS::?pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  Histamine chloride channel cGAL.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs374 [15xUAS::(delta)pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  histamine chloride channel cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs378 [15xUAS::?pes-10::mKate2::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  mKate2 cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs390 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  GFP cGAL effector.  Weak background fluorescence in some head neurons and the head mesodermal cell.  [NOTE: (03/18/2020) a user has reported syIs390 does not map to LG X] Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.