Search Strains

More Fields
Strain Species Genotype Add
VH7172 C. elegans Y71H2AM.6(hd7172[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7173 C. elegans +/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7174 C. elegans atg-5(hd7174[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7176 C. elegans fubl-4(hd7176[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAAACTTTAATAGATACATTTTTGGC; Right flanking sequence: ATACGCTTCTACAATACAACAATCGTTGAA. sgRNA #1: AAAATTACGCCAAACCTGCT; sgRNA #2: ACATTTGAATTATGTTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7183 C. elegans F40G9.19(hd7183[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTACTTTCAGGCCCAAATGTGGAAATTGCG; Right flanking sequence: ACTATATGTGACATTTTGAAGAAGTAATAT. sgRNA #1: GCCTCAAGTACAAGCCTACT; sgRNA #2: TGAATAGTTGATTGGCACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7184 C. elegans C09B9.85(hd7184[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7186 C. elegans +/nT1 [umnls49] IV; algn-5 (hd7175[loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7187 C. elegans hpo-11 (hd7177 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7177 and CGC92. hd7177 is a 7087 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GATGGTCCATTTGTATTAGTTGTTGTACCA; Right flanking sequence: TTTTAGTTGGAACGGCTCGCGCCCAAGCAG. sgRNA #1: CTTGGCTGTGATGATTGACC; sgRNA #2: AAACGGAACAAGGACACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7188 C. elegans +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ lmbr-1(hd7180 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7190 C. elegans rpom-1 (hd7178 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hIn1 [unc-101(sy241)] I. Show Description
Maintain by picking viable fertile wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced with hln1. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ homozygotes, and Unc homozygotes. Derived from parental strains VH7178 and PS1056. hd7179 is a deletion of 12118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGGCGAGGTAACGGGCGAATATTGCCG; Right flanking sequence: AACTGATTCTCAGTTAACCTAACCAATGAT. sgRNA #1: CAAACCCCGTACTTTTCAGG; sgRNA #2: AAGAAGTCGGGCTACTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7191 C. elegans +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ZK632.4(hd7181 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7181 and CGC66. hd7181 is a 1382 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACTTCCTGCACCCAGAACTCATCAATTCCA; Right flanking sequence: AGCCATGCTAGAATTTCCTTTGGGTCCCCA. sgRNA #1: TCACTACTATTTACTCCACG; sgRNA #2: GGAAGTCTTGCATTAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7192 C. elegans coa-7 (hd7182 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7194 C. elegans rnst-2(hd7194[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 4597 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCACCTGTCACTTGACACTCCTTTGTCCA; Right flanking sequence: TTTAAGCCTCAAAATTGTCATGCTAAAAAA. sgRNA #1: CTGGGAAGTGAGCAGTCTAC; sgRNA #2: CCGGGATAAGAAGGTACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7197 C. elegans folt-3(hd7197[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 952 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAATCGCCCAAATTCCAAAAATTATGCCA; Right flanking sequence: AGGAGAGCAGCTCGGGTGTACGCTGTAGCT. sgRNA #1: ATTGTGGTTGCTACTCTTTT; sgRNA #2: AGGCAAGAAATCTTCCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7199 C. elegans cyp-14A1(hd7199[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGTCATTTCTCATCACTGACCACAATTGC; Right flanking sequence: TGGTGAATATTACCAATGAATGGAAGAGGT. sgRNA #1: GCAAAAACTAATGAACCAGC; sgRNA #2: GGTTTGTCCAGTGGCATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7200 C. elegans +/nT1 [umnls49] IV; srpa-68(hd7195[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7195 and CGC63. hd7195 is a 2300 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAACTCTTTTTCCACCCGGAAAGCATTCCA; Right flanking sequence: AAAATATTGAATTTAAATATTTAAATGTTA. sgRNA #1: GAAGAACAACAAGGACTTAC; sgRNA #2: CAGGGAAATGACAAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7201 C. elegans eif-2gamma(hd7196[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7196 and CGC92. hd7196 is a 1856 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TACGCTAATGCAAAGATCTACAGATGTTCT; Right flanking sequence: AGGAAGAGTTACTGCTGTGAAGGGAGACGC. sgRNA #1: AACCAAGAGTGCCCAAGGCC; sgRNA #2: ATTGGATCGTTGTCAACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7203 C. elegans C09B8.4(hd7203[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACTGCCGGTTTTGCACGGAAATGTGCCA; Right flanking sequence: TACCAACGATTCTCTTTCAGTTTTAAATTT. sgRNA #1: CTTCGGAGATACAGAGCACG; sgRNA #2: TTTTGTAATAGGCACTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7206 C. elegans cyp-13A5(hd7206[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1318 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGACCTGCTTAGATTATTAATAGAATACT; Right flanking sequence: TGGATTTTCATAGTCTTGGAACTCGTGAAT. sgRNA #1: TTCCAAAGCGAAGATCAAAT; sgRNA #2: TCTCCCAATTTCAACAGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7207 C. elegans F43C9.2(hd7207[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 6980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTTTTGCAACATACCGAAACTAGAGTA; Right flanking sequence: ACCACGTTTTCACTCAAAGCCCACCCTCCT. sgRNA #1: CACATTCCAATAATACCTCG; sgRNA #2: CATCCAGCTGATGCTTTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7209 C. elegans taap-1(hd7209[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1080 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTAATTTGAAGTTTTCCATTAATTCCA; Right flanking sequence: GGGTTTTTCTTCGCAAGATTCACGTTTCGG. sgRNA #1: GCTTCATAAATGCATATTCC; sgRNA #2: TTTAATGATACTTTTAGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7210 C. elegans pigw-1(hd7204[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with tmC6. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and Dpy mCherry+ homozygotes. Derived from parental strains VH204 and FX30138. hd7204 is a deletion of 3569 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGAACACCAGGCGACTGTATTGAACATTTG; Right flanking sequence: GAATGTCCGAATTTCTCGGTTTTTGCGTAT. sgRNA #1: GATTGATAGGCAGACTCCGG; sgRNA #2: GATGATGGATGTCGGAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7211 C. elegans mrpl-40(hd7198[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP])/ oxTi731 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] III. Show Description
Maintain by picking viable fertile GFP+ and Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III+. Apparent homozygous lethal or sterile deletion stabilized over oxTi731. Heterozygotes are wild-type GFP+ and tdTomato+ and segregate wild-type hereozygotes (GFP+ tdTomato+), hd7198 homozygotes (GFP+), oxTi731 homozygotes (tdTomato+), and occasional hd7198 oxTi731 recombinants. Derived from parental strains VH7198 and EG7887. hd7198 is a deletion of 1473 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACCCGCCAAATTCATCAAACAATTCCCG; Right flanking sequence: CGGCGACTACATTGATACTACGAGAAATTG. sgRNA #1: CATAAAAACCGAGGAGCCGG; sgRNA #2: CGAAACTACGAGGCTCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7212 C. elegans +/nT1 [umnls49] IV; K07F5.15(hd7202[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7202 and CGC63. hd7202 is a 541 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTAAAAACAATGGTTCAAGGAAAGCTCAAG; Right flanking sequence: TTGATGCTCTTTTGTTACGAACTTTATACC. sgRNA #1: CAAAAGACAGCCTTGCCAAA; sgRNA #2: AAAAGTGATTTCGTAGGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7213 C. elegans mrpl-39(hd7213[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAAAAAACGATAAAAAATGCTTATAAAAT; Right flanking sequence: AGGTGATCGCAGTGCCAACGAGTGTAGCAG. sgRNA #1: ATTATTTTCAGACGCTGTCC; sgRNA #2: CCGCGAAGAGAAGCAATTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7214 C. elegans +/nT1 [umnls49] IV; ttr-33(hd7205[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7205 and CGC63. hd7205 is a 672 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GACTCGAACTCAATTTGCATGTTGATAGTT; Right flanking sequence: TGGTTAGAAAAAGATACGGAGAGGAGAAGT. sgRNA #1: CCAATGTTAAAGAAAGTCTT; sgRNA #2: AAACTCTCTTATAGCACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7215 C. elegans mcat-1(hd7179[LoxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + LoxP])/ lin-42(tmIs1226) II. Show Description
Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with FX30266. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and tmIs1226 mCherry+ homozygotes. Derived from parental strains VH7179 and FX30266. hd7179 is a deletion of 1609 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGACATTGCACACCGGACGATGAATCTCCA; Right flanking sequence: TGGAATATCCATCACCTGTAGAAATAAAAA. sgRNA #1: GGCAAAAGCTTTCCAAAACG; sgRNA #2: TCGAAAACTCGCCGTGCCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VT1997 C. elegans maIs105 V; alg-1(ma192) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma192 is a S750F substitution mimicking human AGO1 S750F mutation. Adult ma192 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
VT3118 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3136 C. elegans unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3145 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3178 C. elegans unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3805 C. elegans maIs105 V; alg-1(ma443) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
VT3809 C. elegans alg-1(ma443) X. Show Description
Maintain at 20C. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
VT3823 C.elegans maIs105 V; alg-1(ma447) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma447 is a F180(deletion) mimicking human AGO1 F180 mutation. Adult ma447 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
VT3824 C. elegans alg-1(ma447) X. Show Description
Maintain at 20C. ma447 is a F180(deletion) mimicking human AGO1 F180 mutation. Adult ma447 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
VT573 C. elegans lin-4(e912) II; lin-14(n179) X. Show Description
lin-14(n179) is temperature-sensitive. lin-4; lin-14 double mutant may be maintained at 20C.
VZ1 C. elegans trx-1(ok1449) II. Show Description
B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.
WF1828 C. elegans hda-1(cw2) II. Show Description
hda-1(cw2) mutants are viable as homozygotes, although many die as embryos or larvae. Severely uncoordinated with defective vulval development and reduced fertility. Reference: Zinovyeva AY, et al. Dev Biol. 2006 Jan 1;289(1):229-42. PMID: 16313898
WG300 C.elegans rmIs190; hdEx2. Show Description
rmIs190 [F25B3.3p::Q67::CFP]. hdEx2 [snb-1::ALKBH3(H257A)::BFP::tbb-2 3’UTR + rol-6(su1006)]. Pick Rollers to maintain. BFP fused to the C-terminus of catalytically inactive ALKBH3(H257A) mutant form of ALKBH3. Pan-neuronal CFP expression. Reference: Sun Y, et al. Nature. 2023 Nov;623(7987):580-587. doi: 10.1038/s41586-023-06701-5. PMID: 37938769.
WH408 C. elegans sep-1(e2406) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
WH468 C. elegans sep-1(e2406) I/hT2 (I;III); ruIs32 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
WH485 C. elegans sep-1(e2406) I/hT2 (I;III); ojIs58 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ojIs58 [pie-1p::sep-1::GFP + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
WIN253 C. elegans glh-4(jog16) glh-2(jog49) glh-1(jog50) I. Show Description
Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Engineered mutations of FG repeats in three Vasa like GLH proteins (GLH-1, GLH-2 and GLH-4). glh-1(jog50) is F to A substitution. glh-4(jog16) is F to A substitution. glh-2(jog49) is a deletion of the FG repeats. This strain exhibits a subtle change in germ granule composition while maintaining their architecture. WAGO-4 is mislocalized to the cytoplasm leading to compromised function.
WIN272 C. elegans wago-4(jog272[3xFLAG::GFP::wago-4(Y611E) *gg620]) II. Show Description
Temperature sensitive: maintain at 15-20C. Reduced number of progeny at elevated temperatures. wago-4(jog272) is an engineered Y611E point mutation predicted to disrupt small RNA binding and exhibits a diffuse cytoplasmic localization. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.
WJA1025 C. elegans rps-10(srf1025[rps-10::3xHA]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WM191 C. elegans sago-2(tm894) ppw-1(tm914) ppw-2(tm1120) wago-2(tm2686) wago-1(tm1414) I; wago-11(tm1127) wago-5(tm1113) wago-4(tm1019) II; hrde-1(tm1200) sago-1(tm1195) III; wago-10(tm1186) V; nrde-3(tm1116) X. Show Description
Maintain at 15 C. MAGO12 mutant. RNAi resistant. Temperature sensitive. Reference: Gu, et al. 2009 Mol Cell 36:234-44.
WM206 C. elegans drh-3(ne4253) I. Show Description
Mutator. Dominant RNA-i deficient. Temperature sensitive sterile. Maintain at 15-20 C. ne4253 is a C-to-T transition at position 3896 of the genomic DNA with respect to the +1 position of the ATG creating a T834M missense mutation. Reference: Gu, et al. 2009 Mol Cell 36:234-44.
WM230 C. elegans drh-3(ne3197) I. Show Description
Mutator. Dominant RNAi-deficient. Temperature-sensitive sterile. Maintain at 15-20C. ne3197 is a G840D missense mutation. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44.
WM231 C. elegans drh-3(ne4254) I. Show Description
Mutator. Dominant RNAi-deficient. Temperature-sensitive sterile. Maintain at 15-20C. ne4254 is a G802E missense mutation. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44.