MT13406 |
C. elegans |
mir-34(n4276) X. Show Description
Deletion breakpoints are: AACAACAACAAAAACTTTTTTTACC / ATTTAAAAAAATAA...GAATGGGAAAAAAAA / GGAAGCTGTGGCCTGTCGCATAGTTAC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
VC1051 |
C. elegans |
mir-34(gk437) X. Show Description
Y41G9A.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VT2392 |
C. elegans |
mir-34(gk437) X. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3104 |
C. elegans |
maIs385 I; mir-34(gk437) X. Show Description
maIs385 [lim-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3105 |
C. elegans |
maIs386 I; mir-34(gk437) X. Show Description
maIs386 [myo-3p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3106 |
C. elegans |
maIs387 I; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3123 |
C. elegans |
maIs396 I; mir-34(gk437) X. Show Description
maIs396 [dpy-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3124 |
C. elegans |
maIs397 I; mir-34(gk437) X. Show Description
maIs397 [lag-2p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT2595 |
C. elegans |
mir-83(n4638) IV; mir-34(gk437) X. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT2905 |
C. elegans |
mir-259(n4106) V; mir-34(gk437) X. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3289 |
C. elegans |
mir-83(n4638) IV; mir-34(gk437) X. Show Description
DTC migration defects. Generated from VT3106 and VT3110. VC3289 has the genotype as VT2595 but made from different parental strains. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT2812 |
C. elegans |
unc-54(e190) I; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Paralyzed. DTC migration defect. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT2906 |
C. elegans |
mir-83(n4638) IV; mir-259(n4106) V; mir-34(gk437) X. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3294 |
C. elegans |
maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3118 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3145 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT2885 |
C. elegans |
cdc-42(gk388)/mIn1 [mIs14 dpy-10(e128)] II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Heterozygotes are superficially WT (DTC migration defects) with relatively dim pharyngeal GFP signal, and segregate superficially WT (DTC migration defects) with dim GFP, Dpy with bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT2797 |
C. elegans |
pat-3(st564)/qC1 [dpy-19(e1259) glp-1(q339)] III; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Heterozygotes are superficially WT (with DTC migration defects), and segregate superficially WT (with DTC migration defects), sterile ts-Dpy qC1 homozygotes, and st564 homozygotes (PAT lethal). Pick WT and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|