Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GS1912 C. elegans arIs37 I; dpy-20(e1282) IV. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. GFP is secreted from muscle cells. Do not distribute this strain; other labs should request it from the CGC.
GS9407 C. elegans arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.
GS9820 C. elegans arTi443 Show Description
arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9847 C. elegans arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I (-4.81). First intron of GFP is replaced with a Flexon containing two loxP sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9922 C. elegans arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
HBR762 C. elegans C10C6.7(goe3) IV. Show Description
goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
HBR764 C. elegans C10C6.7(goe5) IV. Show Description
goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
JJ1508 C. elegans unc-119(ed3) III; zuIs60. Show Description
zuIs60 [pie-1p::GFP(secreted) + unc-119(+)]. Maternally-expressed secreted GFP fills spaces between embryonic cells, and space between embryo and vitelline membrane. Useful marker for vizualizing intercellular spaces in embryos. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.
JK2979 C. elegans fbf-1(ok224) II. Show Description
Homozygous. No obvious phenotype by dissecting scope. Do not distribute this strain; other labs should request it from the CGC.
JK3791 C. elegans sys-1(q544) I; qIs95 III. Show Description
qIs95 [(sys-1p::Venus::sys-1 + pttx-3::DsRed]. The DsRed marker is very dim and might be difficult to see it under the dissecting scope. Do not distribute this strain; other labs should request it directly from the CGC.
JMC101 C. elegans csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
JMC164 C. elegans csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
JU1286 C. afra Show Description
Caenorhabditis sp. 7 Male-female strain. Caenorhabditis sp. 7 is currently an undescribed species. The sequenced strain, JU1286, is an isogenic inbred line derived from strain JU1199 by 20 consecutive matings of 1 virgin female and 1 male. The inbreeding was done by Marie-Anne Felix. Strain JU1199 was isolated in June 2007 by Matthias Herrmann from a rotting citrus fruit in Begoro, Ghana, Africa. C. sp. 7 is a gonochoristic species with about equal proportions of males and females.
JU486 C. elegans mfIs4. Show Description
mfIs4 [egl-17::YFP + daf-6::CFP + unc-119(+)]. YFP is expressed in the secondary vulval lineage (vulC, D) and CFP in the primary vulval lineage (vulE, F). egl-17::YFP from the pDRS17 plasmid (D. Sherwood and P. Sternberg). daf-6::CFP from the pCK1 plasmid (C. Kolditz and MA Felix). Slightly Egl, Pvl. unc-119(ed3) might still be present in the background.
KG4247 C. elegans ceIs201 I. Show Description
ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.
KG4731 C. elegans unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
KRA102 C. elegans lin-39(kas1) III; ynIs40 V; unc-3(n3435) X. Show Description
ynIs40 [flp-11p::GFP] V. kas1 is a point mutation in the second intron splice acceptor site, disrupting splicing. Worms are vulvaless and have severe locomotion defects. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LB21 C. elegans nuo-1(ua1)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT and segregate WT (fluorescent), Dpys (highly fluorescent) and L3 lethals (non-fluorescent). GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence. Called LB21B.
LP316 C. elegans hmp-2(cp78[GFP::hmp-2a + LoxP]) III. Show Description
cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
LP728 C elegans mig-5(cp385[mNG-GLO::AID*::mig-5]) II. Show Description
FP knock-in. mNG-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.
LSD1091 C. elegans smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD2104 C. elegans xchIs15. Show Description
xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.
LW1288 C. elegans arIs37 I; sma-6(jj1) II; cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.
LW2367 C. elegans arIs37 I; sma-9(cc604) X. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Tian et al. (2010) Development 137(14):2375-84.
LW557 C. elegans arIs37 I; fozi-1(cc607) cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Missing M-derived coelomocytes and 1-3 body wall muscles. Cells transformed to sex myoblast-like fates. myo-3p::ssGFP is a secreted GFP that it taken up by coelomocytes.
LW614 C. elegans arIs37 I; sma-3(jj3) cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.
MCJ11 C. elegans mir-35(cdb2 cdb4) II. Show Description
Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ217 C. elegans mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MQD753 C. elegans hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About four mitoflash events per anterior pharynx per 200 seconds on adult days 2-3 when cultured on standard NGM plates at 20C. In hqIs180 mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD774 C. elegans daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About two mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD812 C. elegans daf-16(mu86) I; daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About three mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD911 C. elegans hsf-1(sy441) I; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About six mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MSB273 C elegans syIs423 V; mirIs19. Show Description
syIs423 [15xUAS::Δpes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MSB486 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB609 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB657 C. elegans eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; lite-1 (ce314) X. Show Description
loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MT14401 C. elegans set-12(n4442) X. Show Description
Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.
NC1730 C. elegans unc-5(e152) IV; wdIs52. Show Description
wdIs52 [F49H12.4::GFP + unc-119(+)]. PVD defects in primary branch guidance, number of secondary branches, and tertiary branches are longer than wild-type.
NJ228 C. elegans mua-6(rh85) X. Show Description
Poorly growing strain; most homozygotes fail to reach adulthood, and those that do are Egl. smg suppressable and tends to accumulate second site mutations that suppress the Mua phenotype and restore vigorous growth.
NJ602 C. elegans ifc-2(rh209) X. Show Description
Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271.
NJ678 C. elegans ifc-2(rh247) X. Show Description
Homozygous viable, but poor growth and some mortality at lower osmolarity. Large fluid-filled cysts in excretory cell body and shortened canals, sometimes visible with dissecting microscope. Encodes intermediate filament protein. ifc-2 formerly known as exc-2. References: Buechner M, et al. Dev Biol. 1999 Oct 1;214(1):227-41. doi: 10.1006/dbio.1999.9398. PMID: 10491271. Yang Z, et al. J Cell Biol. 2020 Nov 2;219(11):e202003152. doi: 10.1083/jcb.202003152. PMID: 32860501.
NKZ35 C. inopinata Caenorhabditis inopinata wild isolate Show Description
Caenorhabditis inopinata wild isolate; 10x inbred line. Male-Female. Maintain by mating at 25C or above; does not grow well at 20C. See reference for the details d(https://www.nature.com/articles/s41467-018-05712-5). Sibling species of C. elegans. Inbred 10 times, full genome sequence available. Frozen stock recovery is lower efficiency than C. elegans with glycerol; DMSO method works more efficiently. Adult: Large and slender species; ca. 1.5–2.5 mm in length, and individuals may reach up 3.0 mm under optimal culturing conditions. Cuticle is moderate to thick with four-lined lateral field. Deirids on the lateral field, at the level slightly behind the secretory–excretory pore. Lip separated into six sectors, not clearly offset. Six labial sensilla and four cephalic sensilla present. The anterior end of each lip sector very slightly elongated and forming six stomatal flaps. Amphid small, oval pore-like, at the level of the margin of cheilo and gymnostom. Tube-like stoma separated into three parts; short tube-like cheilostom; simple tube-like gymnostom, which is weakly separated into two subsections; and tube-like stegostom covered by pharyngeal sleeve, which is separated into four subsections, prostegostom, mesostegostom, metastegostom, and telostegostom. Metastegostomatal three teeth flap-like. Pharynx separated into four sections; procorpus forming muscular tube, well-developed metacorpus (median bulb); glandular and narrow isthmus; and basal bulb with double haustrulum as the glottoid apparatus. Pharyngo-intestinal valve (cardia) prominent. Nerve ring around the middle of isthmus. Excretory pore located around the margin of isthmus and basal bulb. Female: Gonadal system didelphic, amphidelphic. Anterior and posterior gonadal system are basically symmetric with each other, arranged as ovary, oviduct, spermatheca, spermathecal-uterus junction tissue, uterus and vulva/vagina from distal. Sometimes more than 20 developing eggs are deposited. Tail conical or forming slightly elongated conus with pointed tip. Anus and rectum clearly visible; three (two subventral and one dorsal) rectal glands present. Phasmid forming small pore at ca. 60% of total tail length from anus. Male: Testis single, anteriorly reflexed rightwardly. Vas deferens occupying ca. 1/5 of total gonadal length. Tail enveloped by a closed bursa, supported by nine pairs of bursal rays. Anterior cloacal lip with a rounded and sclerotized appendage and bulge-like appendage between rounded appendage and cloacal opening; a small sensilla-like papilla on the bulge-like appendage. Posterior cloacal lip with tongue-like appendage with two cloacal sensilla. Spicules paired, separate, long and slender with evenly slightly ventrally curved blade and simply pointed tip. Gubernaculum slender, ventrally arcuate with small squared appendage at the distal end in lateral view. Bursa heart-shaped in ventral view, anteriorly closed with serrated edge; serratae obvious in anterior half and vague in posterior half; terminal notch present but unclear. The nine pairs of genital papillae or bursal rays supporting the bursal velum with an arranged (2/1 + 1 + 2 + 3).
NM306 C. elegans jsIs1. Show Description
jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Rollers. GFP expressed in the nerve ring, ventral cord and dorsal cord. Received new stock 3/10/2008 from Mike Nonet. Faint signal using a dissecting microscope. Obvious signal using a compound microscope (40X oil).
NM3576 C. elegans jsIs1072 I. Show Description
jsIs1072 [vha-6p::aex-5::Venus + Cbr-unc-119(+)]. Wild type strain that expresses AEX-5::VENUS fusion in intestine under the control of the vha-6 promoter. AEX-5::VENUS is secreted and also detectable in the coelomocytes. Created by ballistic transformation. Plasmid sequence and description of the transgene found in PMID 18852466.
NM547 C. elegans unc-64(js21) III. Show Description
Aldicarb resistant. Unc. A241V mutant (C to T in second base of codon).
NM833 C. elegans snb-1(js44) V. Show Description
Aldicarb resistant. Unc. A65G mutant (C to T in second base of codon).
NP1360 C. elegans arIs37 I; cup-14(cd31) II. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.
OH10892 C. elegans otIs374. Show Description
otIs374 [unc-47p(300bp)::mChopti::unc-54 3'UTR + pha-1(+)]. mChopti is visible under dissecting scope.
OH172 C. elegans lin-15B&lin-15A(n765) X; otEx105. Show Description
otEx105 [lim-7::GFP + lin-15(+)]. Highly penetrant line, but non-Muv/Muv does not correlate well with presence/absence of extrachromosomal array. Maintain by picking GFP-positive animals under GFP-dissecting scope. GFP strongly expressed in gonad sheath cell pair 1.