Strain Information
| Name | LSD1097 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | smg-1(cc546) I; xchEx97. |
| Description | xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
| Mutagen | No mutagen |
| Outcrossed | x0 |
| Made by | Eline Jongsma |
| Laboratory | LSD |
| Reference | Elisabeth Jongsma Anita Goyala José Maria Mateos Collin Yvès Ewald (2023) Removal of extracellular human amyloid beta aggregates by extracellular proteases in C. elegans eLife 12:e83465. https://doi.org/10.7554/eLife.83465 |
Sign in
or
register an account if you want to order this strain.