More Fields
Strain Species Genotype
CFJ191 C. elegans kstSi32 I; unc-119(ed3) III; kstEx45. Show Description
kstSi32 [Cbr-unc-119(kst13)] I. kstEx45 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CFJ192 C. elegans unc-119(ed3) III; kstSi37 IV; kstEx46. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CGC105 C. elegans hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
CGC128 C. elegans +/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC138 C. elegans unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs79] V. Show Description
umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC139 C. elegans unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC18 C. elegans umnIs7 III. Show Description
umnIs7 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC19 C. elegans eT1 III; eT1 [umnIs8] V. Show Description
umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC20 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs9] V. Show Description
umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC22 C. elegans umnIs11 V. Show Description
umnIs11 [myo-2p::GFP + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC23 C. elegans dpy-18(e364)/eT1 [umnIs12] III; unc-46(e177)/eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC24 C. elegans umnIs13 X. Show Description
umnIs13 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC25 C. elegans hT2 [umnIs14] I; hT2 [bli-4(e937)] III. Show Description
umnIs14 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] I. Homozygous viable. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC26 C. elegans dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC27 C. elegans umnIs16 X. Show Description
umnIs16 [myo-2p::GFP + NeoR, X:15420938 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC28 C. elegans +/szT1 [lon-2(e678) umnIs17] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC29 C. elegans unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC30 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f). Show Description
umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
CGC31 C. elegans umnIs20 III. Show Description
umnIs20 [myo-2p::GFP + NeoR, III:518034 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC32 C. elegans sC1(s2023) [dpy-1(s2170) umnIs21] III]. Show Description
umnIs21 [myo-2p::GFP + NeoR, III: 518034 (intergenic)]. Dpy GFP+. Derived by insertion of myo-2p::GFP transgene into sC1 balancer in parental strain BC4279 using CRISPR/Cas9.
CGC33 C. elegans unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC34 C. elegans eT1 [umnIs12] III; eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC35 C. elegans +/szT1 [lon-2(e678) umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC36 C. elegans mnDp1 [umnIs25] (X;V)/+ V; unc-3(e151) X. Show Description
umnIs25 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates lethals: homozygous Dp/Dp are lethal. Derived by insertion of myo-2p::GFP transgene into mnDp1 duplication in parental strain SP219 using CRISPR/Cas9.
CGC37 C. elegans unc-3(e151) X; mnDp3 [umnIs26] (X;f). Show Description
umnIs26 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates wild-type GFP+ and Unc GFP-. Derived by insertion of myo-2p::GFP transgene into mnDp3 duplication in parental strain SP123 using CRISPR/Cas9.
CGC38 C. elegans umnIs27 III. Show Description
umnIs27 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC39 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC40 C. elegans +/szT1 [lon-2(e678) umnIs29] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs29 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-GFP, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC41 C. elegans +/szT1 [lon-2(e678) umnIs30 umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.
CGC42 C. elegans mnDp10 [umnIs31] (X;I); unc-3(e151) X. Show Description
umnIs31 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Segregates mostly wild-type GFP+ and occasional Unc GFP-. Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnDp10 duplication in parental strain SP117 using CRISPR/Cas9.
CGC43 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.
CGC44 C. elegans mIn1 [dpy-10(e128) umnIs33]/unc-4(e120) II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-4 non-GFP, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.
CGC45 C. elegans unc-4(e120)/mT1 [umnIs34] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. Show Description
umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC46 C. elegans +/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs35] X. Show Description
umnIs35 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC47 C. elegans hT2 I; hT2 [bli-4(e937) umnIs36] III. Show Description
umnIs36 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and mKate2. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC48 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
CGC49 C. elegans hT2 I; hT2 [bli-4(e937) umnIs38] III. Show Description
umnIs38 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and GFP. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC50 C. elegans +/szT1 [lon-2(e678) umnIs39] I; dpy-8(e1321) unc-3(e151)/szT1 [umnIs40] X. Show Description
umnIs39 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs40 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs, and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by simultaneous insertion of independent myo-2p::mKate2 and myo-2p::GFP transgenes into each portion of the szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC51 C. elegans sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.
CGC52 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs42] III. Show Description
umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC53 C. elegans mIn1 [dpy-10(e128) umnIs43]/unc-4(e120) II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2, Unc-4 non-mKate2, and Dpy mKate2+ mIn1 homozygotes. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.
CGC54 C. elegans umnIs44 II. Show Description
umnIs44 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
CGC55 C. elegans eT1 [umnIs45] III; eT1 V. Show Description
umnIs45 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC57 C. elegans umnIs47 III. Show Description
umnIs47 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
CGC58 C. elegans C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC59 C.elegans gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC60 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC61 C. elegans F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC62 C.elegans umnIs48 V. Show Description
umnIs48 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.