More Fields
Strain Species Genotype
VC1349 C. elegans nhr-47(gk954) V. Show Description
C24G6.4. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 742 bp. Deletion left flank: TTAATAATTCAATAATGTAAATTATTGAAT. Deletion right flank: GTAAGATCAATTTAACAAGCATCAAACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
OP481 C. elegans unc-119(tm4063) III; wgIs481. Show Description
wgIs481 [nhr-47::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
RW11528 C. elegans unc-119(tm4063) III; stIs11528. Show Description
stIs11528 [nhr-47::H1-wCherry + unc-119(+)].
JMC101 C. elegans csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
JMC151 C. elegans csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
JMC164 C. elegans csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
JMC245 C. elegans alg-4(tm1184) III; csr-1(tor67[csr-1 exon2::gfp::3xflag (IV:7958598)], csr-1(mg660[G120*])) alg-3(tm1155) IV; wago-10(tor133) V. Show Description
Quadruple mutant of four spermatogenesis-specific ago genes. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
OD1175 C elegans Show Description
Heterozygous for CSR-1 deletion are Unc. Homozygous for csr-1(tm892) are non-Unc and Sterile. Transgenes seem to be silenced after a few generations, since non-uncs gradually become sterile! - must keep re-freezing immediately after thawing a new tube
OD1235 C. elegans ltSi386 I; ltSi240 II; unc-119(ed3) III; csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
ltSi386 [hcp-3p::GFP::hcp-3(re-encoded) + Cbr-unc-119(+)] I. ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The hcp-3 and csr-1 coding sequences in the transgenes were re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.
OD1236 C. elegans ltSi386 I; ltSi242 II; unc-119(ed3) III; csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
ltSi386 [hcp-3p::GFP::hcp-3(re-encoded) + Cbr-unc-119(+)] I. ltSi242 [csr-1p::csr-1(re-encoded; D606A, D681A: isoform b numbering) + Cbr-unc-119(+)] II. The hcp-3 and csr-1 coding sequences in the transgenes were re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.
OD1340 C. elegans ltSi386 I; unc-119(ed3) III; csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
ltSi386 [hcp-3p::GFP::hcp-3(re-encoded) + Cbr-unc-119(+)] I. The hcp-3 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Unc worms are heterozygous for csr-1(tm892), non-Unc worms are homozygous for csr-1(tm892). Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.
OD1463 C. elegans ltSi240 II; unc-119(ed3) III; csr-1(tm892) IV/nT1[unc-?(n754)let-?] (IV;V). Show Description
ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.
OD1764 C. elegans ltSi448 II; unc-119(ed3) III; ltIs37 csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
ltSi448 [csr-1p::GFP::csr-1(re-encoded; GFP inserted after aa #5 of isoform b) + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.
OD4027 C. elegans ltSi448 II; unc-119(ed3) III; ltIs37 csr-1(tm892) IV. Show Description
ltSi448 [csr-1p::GFP::csr-1(re-encoded; GFP inserted after aa #5 of isoform b) + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1764; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.
OD4028 C. elegans ltSi240 II; unc-119(ed3) III; csr-1(tm892) IV. Show Description
ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1463; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.
OD923 C. elegans ltSi240 II; unc-119(ed3) III. Show Description
ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). Reference: Gerson-Gurwitz, et al. Cell. 2016 Apr 7;165(2):396-409.
OD925 C. elegans ltSi242 II; unc-119(ed3) III. Show Description
ltSi242 [csr-1p::csr-1(re-encoded; D606A, D681A: isoform b numbering) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). Reference: Gerson-Gurwitz, et al. Cell. 2016 Apr 7;165(2):396-409.
WM182 C. elegans csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. csr-1(tm892) homozygotes are non-Unc and Sterile.
WM193 C. elegans csr-1(tm892) IV; neIs20. Show Description
neIs20 [pie-1::3xFLAG::csr-1 + unc-119(+)]. Partially rescues sterility (60% dead embryos). Unknown if unc-119(ed3) is still present in the background. Reference: Claycomb J, et al. 2009 Cell 139:123-34.
WM194 C. elegans csr-1(tm892) IV; neIs20. Show Description
neIs20 [pie-1::GFP::csr-1 + unc-119(+)]. Partially rescues sterility (60% dead embryos). Unknown if unc-119(ed3) is still present in the background. Reference: Claycomb J, et al. 2009 Cell 139:123-34.
WM214 C. elegans avr-14(ad1302) I; csr-1(tm892)/nT1 [unc-?(n754) let-?] IV; avr-15(ad1051) glc-1(pk54))/nT1 V; axIs36 X. Show Description
axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. csr-1 homozygotes are basically sterile, but some of them occasionally lay a small number of dead eggs. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. Homozygous nT1[qIs51] inviable.