Search Strains

Variable phenotypes, slightly dumpy and/or uncoordinated, especially at 25C. Grows poorly at 15C. Low fertility. sup-33(st389) is a weak amber suppressor; e2017 and e138 are amber mutations. Reference: Kondo K, et al. (1990) J Mol Biol. 1990 Sep 5;215(1):7-19.

Wild-type hermaphrodites segregating wild-type hermaphrodites, Unc-24 females, Unc Dpy hermaphrodites. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.

Small, severely uncoordinated. Spontaneous segregant from N2/RW7000 (Bristol/Bergerac) hybrid strain. Daf-d.

Weak Tra-2 allele, homozygous self-fertile XX. Slightly masculinized hermaphrodite, adults lack tail spike. Reference: Hodgkin & Barnes (1991) PMID: 1684664.

Small. Recessive. Males abnormal-abnormal spicules. M-MATING-NO SUCCESS.

Male/female strain which must be maintained by mating. spe-12(hc76) prevents self-fertility in hermaphrodites but does not impair spermatogenesis in males. Presence of him-8(e1489) increases male frequency.

Small. Recessive. Male spicules abnormal. M-MATING-NO SUCCESS. Synthetic lethal common.

Attached X chromosome line. Long hermaphrodites with low fertility, producing some X^X X^X dead eggs. May spontaneously revert to unattached lon-2 XX. Reference: Hodgkin & Albertson (1995) PMID: 8647390.

Hermaphrodites have abnormal truncated or blebbed tails, pale appearance, some excretory cell abnormalities, especially in adults. Males have variably abnormal tails, some are able to mate.

Vab XX hermaphrodites and XO males, viable at all temperatures. Adult hermaphrodite tail spike is invariably shortened and/or vacuolated, often also abnormal in larvae. Possible excretory cell abnormalities. Rays of adult male tail variably abnormal, other structures normal; males can mate.

let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.

Abnormal response to infection by Microbacterium nematophilum (no tail swelling). Abnormal lectin staining.

Abnormal response to infection by Microbacterium nematophilum (no tail swelling).

Notched head. Recessive. 100% Penetrance. Male spicules abnormal. M-MATING-NO SUCCESS. See also WBPaper00002236.

Shaker Unc. Reverts spontaneously. M-MATING-NO SUCCESS.

Most L1 larvae are deformed with irregular shapes. Older larvae and adults exhibit variably bent-head. Resembles spon-1(e2623) II. Homozygous viable, but inviable as hemizygotes (e1210/maDf2). Reference: Hodgkin (unpublished).

Slightly skiddy, bleach-sensitive, drug-sensitive, Bus (M. nematophilum resistant), Bah (Yersinia biofilm resistant), Leucobacter Verde1 hypersensitive. CRISPR/Cas9-induced deletion. Reference: O'Rourke et al (in preparation).

Segregates males. Recessive. Non-disjunction X-specific. M-MATING++ 1-10%WT.

Short, round-headed, especially in early larvae. Adults have slight rolling tendency. Males can mate.

M-MATING+POOR <1%WT. Adult blistered, especially head.

Unc-weak coiler, especially in reverse; moves forward well; sluggish; short.

Notched head. Tail abnormalities. Variable expression. Incomplete penetrance. Especially seen in L1. M-MATING++++ >30%WT. See also WBPaper00003843 and WBPaper00003865. Previously called efn-1(e96).

ep369 is a weak allele. ep6 is a deletion allele. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).

Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).

Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.

muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.

mig-2 null mutation. Animals look grossly WT but Q descendants and other migratory neurons misplaced.

muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]

muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.

Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.

Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.

Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.

muEx340 [ges-1p::RFP + ges-1p::ins-7]. Intestinal expression of ins-7 shortens lifespan. Pick RFP animals to maintain.

muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628