Strain Information
| Name | CER529 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | sftb-1(cer144) III. |
| Description | Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Xènia Serrat |
| Laboratory | CER |
| Reference | Serrat X, Kukhtar D, Cornes E, Esteve-Codina A, Benlloch H, Cecere G, Cerón J. (2019) CRISPR editing of sftb-1/SF3B1 in Caenorhabditis elegans allows the identification of synthetic interactions with cancer-related mutations and the chemical inhibition of splicing. PLOS Genetics 15(10): e1008464. https://doi.org/10.1371/journal.pgen.1008464 |
Sign in
or
register an account if you want to order this strain.