Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AG416 C. elegans pezo-1(av149) IV. Show Description
av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.
BL5752 C. elegans inIs181; inIs182. Show Description
inIs181 [ida-1p::GFP]. inIs182 [ida-1p::GFP]. This is a strain in which two integrated copies of the same construct were crossed into a single strain in order to have stronger expression. Both arrays contain pTZ3i, which is ida-1::GFP with 2.4 kb of ida-1 promoter driving expression of ida-1::GFP fusion proten with ida-1 introns 3-9 included.
BN1007 C. elegans +/mT1 [umnIs34] II; baf-1(bq24[G>F>P::baf-1[G12T]])/mT1 [dpy-10(e128)] III. Show Description
umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ (pharynx), Maternal effect lethal (Mel) non-GFP, sterile Dpy GFP+ (pharynx) mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. GFP tag inserted into N-terminus of endogenous baf-1(G12T) using CRISPR/Cas9. FRT sites in GFP introns 1 & 2 (indicated by ">" symbols in genotype) enable FLP-mediated conditional gene knockout. BAF-1(G12T) is a model for Nestor-Guillermo Progeria Syndrome. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.
BN1018 C. elegans npp-19(bq29[G>F>P::npp-19]) bqSi189 II. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. GFP tag inserted into N-terminus of endogenous npp-19 using CRISPR/Cas9. FRT sites in GFP introns 1 & 2 (indicated by ">" symbols in genotype) enable FLP-mediated conditional gene knockout. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Thomas L, et al. EMBO J. 42(13): e112987. doi: 10.15252/embj.2022112987. PMID: 37254647.
BN1082 C. elegans npp-2(bq38[gfp(FRT)::npp-2]) I; bqSi189 II. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous npp-2 inserted by CRISPR/Cas9 after the npp-2 start codon. FRT sites in GFP introns 2 & 3. Ubiquitous expression of mCh::HIS-58. Might carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN1112 C. elegans bqSi189 II; npp-25(bq41[npp-25::G>F>P]) III. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. npp-25(bq41[npp-25::G>F>P]) III. GFP tag inserted into C-terminus of endogenous npp-25 locus using CRISPR/Cas9. FRT sites in GFP introns 1 & 2 (indicated by ">" symbols in genotype) enable FLP-mediated conditional gene knockout. Might still carry unc-119(ed3) or unc-119(ed9) in the background. Reference: El Mossadeq L, et al. J Cell Biol. 224(3): e202403125. doi: 10.1083/jcb.202403125. PMID: 39724138.
BN580 C. elegans baf-1(bq12[gfp(FRT)::baf-1]) III. Show Description
GFP cassette for labeling and FLP-mediated inactivation of baf-1 inserted by CRISPR/Cas9 after the baf-1 start codon. FRT sites in GFP introns 2 & 3.
BN740 C. elegans npp-24(bq15[gfp(FRT)::npp-24]) bqSi189 II. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the npp-248 start codon. FRT sites in GFP introns 1 & 2 enable FLP-mediated conditional knockout; in the absence of FLP, the construct behaves as normal GFP. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas L, et al. bioRxiv 2022.08.22.504855; doi: https://doi.org/10.1101/2022.08.22.504855
BN793 C. elegans bqSi189 II; mel-28(bq17[gfp(FRT)::mel-28]) III. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the mel-28 start codon. FRT sites in GFP introns 2 & 3. Ubiquitous expression of mCherry::HIS-58. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
CER554 C. elegans comt-4(cer157[comt-4p::GFP::H2B]) V. Show Description
No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
CER588 C. elegans cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. Show Description
Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
CER660 C. elegans cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III. Show Description
Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.
EG5767 C. elegans qqIr7 I; oxSi78 II; unc-119(ed3) III. Show Description
qqIr7 [peel-1(qq99)] I. oxSi78 [peel-1p::peel-1 (introns included)::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. Genetic background is a mixture of N2 and wild isolate EG4348. The oxSi78 insertion produces a PEEL-1::GFP translational fusion. PEEL-1::GFP is expressed in the spermatogenic germline and packaged into sperm. PEEL-1::GFP appears to localize to fibrous body-membranous organelles. PEEL-1::GFP does not rescue peel-1(qq99). Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG9615 C. elegans xSi1091 II; unc-119(ed3) III. Show Description
oxSi1091 [mex-5p::Cas9 (+ smu-2 introns)::tbb-2 3'UTR + unc-119(+)] inserted into ttTi5605 II. Superficially wild-type. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9747 C. elegans oxSi1106 II; unc-119(ed3) III. Show Description
oxSi1106 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + lox2272] II. Unc. Integrated Cas9 transgene inserted into ttTi5605 MosSci site. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9876 C. elegans unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9881 C. elegans unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9882 C. elegans F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9885 C. elegans W01A8.6(oxTi1120) I; unc-119(ox819) III. Show Description
oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9887 C. elegans W01A8.6(oxTi1128) I; unc-119(ox819) III. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9888 C. elegans W01A8.6(oxTi1128) I. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9891 C. elegans unc-119(ox819) III; W03F9.11(oxTi1121) V. Show Description
oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
GR1322 C. elegans pdk-1(sa680) X; mgEx470. Show Description
mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.
GR1672 C. elegans mgEx340. Show Description
mgEx340 [akt-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-1::GFP translational fusion containing 6.7 kb akt-1 genomic DNA including 3.2 kb of 5' upstream regulatory region and 3.5 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.
GR1673 C. elegans mgEx341. Show Description
mgEx341 [akt-2::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-2::GFP translational fusion containing 5.2 kb akt-1 genomic DNA including 2.1 kb of 5' upstream regulatory region and 3.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.
GR1674 C. elegans mgEx481. Show Description
mgEx481 [pdk-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. PDK-1::GFP translational fusion containing 9 kb akt-1 genomic DNA including 2.9 kb of 5' upstream regulatory region and 6.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.
GR2116 C. elegans mgEx579. Show Description
mgEx579 [ins-18p::GFP + rol-6(su1006)]. Pick Rollers to maintain. ins-18::GFP promoter fusion containing 4.9 kb upstream regulatory sequence and 2.1 kb of coding region (including exons and introns) driving GFP expression with 0.8 kb downstream sequence. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.
GS8729 C. elegans arSi12. Show Description
arSi12 [mex-5p::ERK::KTR::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi12 is a single-copy CRISPR/Cas9-engineered insertion expressing a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8752 C. elegans arSi15. Show Description
arSi15 [mex-5p::ERK::KTR(S43A, T55A, S62A)::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi15 is a single-copy CRISPR/Cas9-engineered insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Use arSi15 as a negative control for transgene arSi12. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS9801 C. elegans rde-1(ar660) V. Show Description
rde-1(ar660[rde-1(lox2272-flexon-lox2272)]). 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
GS9802 C. elegans rde-1(ar660) V; arTi237 X Show Description
arTi237 [ckb-3p::Cre(opti)] (X:11.72). rde-1(ar660[rde-1(lox2272-flexon-lox2272)]). 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
HA3703 C. elegans tdp-1(tgx58) I. Show Description
Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305.
MSB1247 C. elegans oxSi1091 II; unc-119(ed3) III; oxTi553 V. Show Description
oxSi1091 [mex-5p::Cas9 (+ smu-2 introns)::tbb-2 3'UTR + Cbr-unc-119(+)] II. Slightly sick at 25, mantain at 20C. Cas9 expression in the germline. oxTi553 [eft-3p::tdTomato::H2B] V. Broad nuclear tdTomato expression. Reference: Malaiwong N, et al. G3 (Bethesda). 2023 May 2;13(5):jkad041. doi: 10.1093/g3journal/jkad041. PMID: 36805659.
PS4263 C. elegans egl-30(md186) I; dpy-20(e1282) IV; syIs105. Show Description
syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.
SUR10 C. elegans rubSi6 II; rubSi7 IV. Show Description
rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3’UTR] II. rubSi7 [eft-3p::24xGCN4::T2A::tagBFP::H2B::tbb-2 3’UTR]) IV. SunTag system allows visualization of translation throughout development in real-time. This strain expresses a SunTag reporter mRNA (24xGCN4::T2A::tagBFP::H2B::tbb-2 3’UTR ) and a SunTag antibody (scFv::GFP). In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. rubSi7 was inserted into cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
SUR54 C. elegans wrdSi23 I; rubSi6 II; rubSi8[*rubSi7] IV; ltIs44 V. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3’UTR] II. rubSi8 [eft-3p::24xGCN4::AID::T2A::tagBFP::H2B::tbb-2 3’UTR *rubSi7]) IV. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. SunTag system allows visualization of translation throughout development in real-time. In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, bright clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters in the absence of auxin, but not in the presence of auxin. Bright BFP signal from mTagBFP2::AID*::NLS and TagBFP::H2B can be visible in nuclei in the absence of auxin, in the presence of auxin only dimmer TagBFP::H2B is visible in nuclei. mCherry::PH marks the cell membranes throughout development. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. rubSi8 derived by modification of insertion of an AID tag into rubSi7, which is located in cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
SUR72 C. elegans rubSi6 II. Show Description
This strain expresses a SunTag antibody (scFv::GFP) throughout development. GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. rubSi6 [eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3’UTR] was inserted into ttTi5605, and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3’UTR) downstream of the tbb-2 3’UTR in the intact transgene. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
SX3073 C. elegans mjIs588 II; unc-119(ed3) III Show Description
mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
SZ345 C. elegans unc-73(e936az30) dxbp-1(az121) I; smg-4(az152) V. Show Description
dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.