More Fields
Strain Species Genotype
CB3168 C. elegans him-1(e879) I; mab-3(e1240) II. Show Description
Lineage abnormal. Bursae abnormal. Segregates abnormal males. M-MATING-NO SUCCESS.
CB879 C. elegans him-1(e879) I. Show Description
Segregates males. Recessive. Non-disjunction X-specific. M-MATING++ 1-10%WT.
DR222 C. elegans him-1(e879) I; dpy-13(e184) IV. Show Description
Dpy. Segregates males.
DR223 C. elegans him-1(e879) I; sqt-1(e1350) II. Show Description
Dpy. Segregates males. Semi-dominant Roller.
DR226 C. elegans him-1(e879) unc-54(m36) I. Show Description
Unc. Semi-parlayzed. Segregates males. Heterozygotes are slow moving.
PJ1100 C. elegans him-1(e879) I; let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and almost sterile (brood size is 6). Males appear to mate poorly - not quantitatively measured but very poor success with matings.
RG3379 C. elegans ugt-47(ve879[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1932 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTTCAGTCAGCAATTCATGAACTCCT ; Right flanking sequence: CAATCCTACCATTTGATATTAAATGTGATT. ugt-47 sgRNA #1: GAGTGGGTTATTCAGAATGG; ugt-47 sgRNA #2: CTGATGAATTGGCAAAAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SP140 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-28(mn28) II. Show Description
Hets are WT and segregate WT, dead eggs, paralyzed DpyUnc and males. Maintain by picking WT.
SP142 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-30(mn30) unc-4(e120) II. Show Description
Maintain strain by picking WT hermaphrodites. Segregates WT, dead eggs, paralysed DpyUnc and males.
SP143 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-31(mn31) unc-4(e120) II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, L1 Lethal Unc-4s and males. Maintain by picking WT.
SP144 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-32(mn32) II. Show Description
Hets are WT and segregate WT, dead eggs, paralysed DpyUnc and males. Maintain by picking WT.
SP152 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/zyg-11(mn40) unc-4(e120) II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, Sterile Unc-4, and males. Maintain by picking WT.
ZT65 C. elegans him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.