Strain Information
Name | CER588 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | cat-2(cer181[cat-2p::gfp::H2B 1-3]) II. |
Description | Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130 |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Carmen Martínez-Fernández |
Laboratory | CER |
Reference | Insights into cisplatin-induced neurotoxicity and mitochondrial dysfunction in Caenorhabditis elegans. Carmen Martínez-Fernández, Milana Bergamino, Alfonso Schiavi, David Brena, Natascia Ventura, Sebastian Honnen, Alberto Villanueva, Ernest Nadal, Julián Cerón. Disease Models & Mechanisms. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. |
Sign in
or
register an account if you want to order this strain.