Strain Information

Name CER588   View On Wormbase
Species C. elegans
Genotypecat-2(cer181[cat-2p::gfp::H2B 1-3]) II.
DescriptionAbnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
MutagenCrispr/Cas9
Outcrossedx0
Made byCarmen Martínez-Fernández
Laboratory CER
Reference Insights into cisplatin-induced neurotoxicity and mitochondrial dysfunction in Caenorhabditis elegans. Carmen Martínez-Fernández, Milana Bergamino, Alfonso Schiavi, David Brena, Natascia Ventura, Sebastian Honnen, Alberto Villanueva, Ernest Nadal, Julián Cerón. Disease Models & Mechanisms. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161.
Sign in or register an account if you want to order this strain.