Small. Recessive. Male spicules abnormal. M-MATING-NO SUCCESS. Synthetic lethal common.

Temperature sensitive emb-30 allele. Maintain at 15C. Small. Unc. Cell death abnormal.

Heterozygotes are SmaCed and segregate SmaCed, SmaCedUnc and dead eggs. Maintain by picking SmaCed. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).

Heterozygotes are Ced and segregate Ced, dead eggs and SmaCedUncs. Maintain by picking Ced. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).

Very small. Small brood size (about 1/10 that of WT). Grows very slowly. Reference: Watanabe, N et al. Genes to Cells 2007. 12(5):603-609.

Heterozygotes are WT and segregate WT, SmaUnc and dead eggs. Maintain by picking WT.

Small. Maternal effect persistent cell corpses.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Small body size. Slow growth. Strong lacZ staining in body wall.

Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT, Smalls which produces dead eggs, and Dpy Steriles. Throws males.