cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.

Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.

cerIs7 [lsm-1::GFP(fosmid) + unc-119(+)]. cerIs7 rescues all the temperature-sensitive phenotypes of lsm-1(tm3585). Reporter contains full-length lsm-1 tagged with GFP. GFP was inserted into a fosmid containing lsm-1. GFP is expressed diffusely in the cytoplasm of somatic cells. Under heat shock conditions, GFP accumulates forming cytoplasmic foci. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.

cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

eGFP tag inserted into the endogenous nfki-1 locus. eGFP::NFKI-1 signal is observed in diverse neurons in the animals' head and tail throughout post-embryonic development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130