Strain Information
| Name | CER374 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | trxr-1(cer55[Sec666X]) IV. |
| Description | Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
| Mutagen | No mutagen |
| Outcrossed | x0 |
| Made by | Carmen Martínez |
| Laboratory | CER |
| Reference | Genetic and cellular sensitivity of Caenorhabditis elegans to the chemotherapeutic agent cisplatin. García-Rodríguez FJ, Martínez-Fernández C, Brena D, Kukhtar D, Serrat X, Nadal E, Boxem M, Honnen S, Miranda-Vizuete A, Villanueva A, Cerón J. Dis Model Mech. 2018 Jun 21;11(6). |
Sign in
or
register an account if you want to order this strain.