Strain Information
| Name | CER444 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | sftb-1(cer114[mCherry::sftb-1]) III. |
| Description | Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Xènia Serrat |
| Laboratory | CER |
| Reference | Serrat X, Kukhtar D, Cornes E, Esteve-Codina A, Benlloch H, Cecere G, Cerón J. (2019) CRISPR editing of sftb-1/SF3B1 in Caenorhabditis elegans allows the identification of synthetic interactions with cancer-related mutations and the chemical inhibition of splicing. PLOS Genetics 15(10): e1008464. https://doi.org/10.1371/journal.pgen.1008464 |
Sign in
or
register an account if you want to order this strain.