Strain Information
| Name | CER348 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | trxr-1(cer35[Sec666C]) IV. |
| Description | Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Dmytro Kukhtar |
| Laboratory | CER |
| Reference | Genetic and cellular sensitivity of Caenorhabditis elegans to the chemotherapeutic agent cisplatin. García-Rodríguez FJ, Martínez-Fernández C, Brena D, Kukhtar D, Serrat X, Nadal E, Boxem M, Honnen S, Miranda-Vizuete A, Villanueva A, Cerón J. Dis Model Mech. 2018 Jun 21;11(6). |
Sign in
or
register an account if you want to order this strain.