More Fields
Strain Species Genotype
CB1112 C. elegans cat-2(e1112) II. Show Description
Catecholamine absent. Recessive. M-MATING+++ 10-30%WT. See also WBPaper00003844.
MT15620 C. elegans cat-2(n4547) II. Show Description
1,010 bp deletion in cat-2. Reference: Omura D, et al. (2012) PLoS One. 2012;7(6):e38649.
TG2394 C. elegans cat-2(e1112) II; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
CER588 C. elegans cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. Show Description
Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
HZ66 C. elegans sop-2(bp186) II; him-5(e1490) bxIs16 V. Show Description
bxIs16 [cat-2::YFP + tph-1::CFP]. Temperature sensitive: lethal at 25C. Maintain at 20C.
HZ67 C. elegans him-5(e1490) bxIs16 V; sor-3(bp185) X. Show Description
bxIs16 [cat-2::YFP + tph-1::CFP]. Temperature sensitive: lethal at 25C. Maintain at 20C.
OH10196 C. elegans ceh-43(tm480) III; him-5(e1490) V; nIs118; norEx41. Show Description
nIs118 [cat-2::GFP]. norEx41 [ceh-43 fosmid + dat-1::mCherry]. Him. tm480 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
OH7547 C. elegans otIs199. Show Description
otIs199 [cat-2::GFP + rgef-1(F25B3.3)::DsRed + rol-6(su1006)]. Rollers. GFP expressed in dopaminergic neurons and dsRed expressed pan-neuronally. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH7917 C. elegans ast-1(ot417) II; otIs199. Show Description
otIs199 [cat-2::GFP + rgef-1(F25B3.3)::DsRed + rol-6(su1006)]. Rollers. No cat-2::GFP expression in DA neurons (CEP, ADE, PDE). Maintain under normal conditions. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
PHX4698 C. elegans cat-2(syb4698[cat-2::T2A::NeonGreen]) II. Show Description
NeonGreen tag inserted into endogenous cat-2 locus. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-Martín A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
PHX8255 C. elegans cat-2(syb8255[cat-2::SL2::GFP::H2B]) II. Show Description
Endogenous cat-2 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi:
UA57 C. elegans baIs4. Show Description
baIs4 [dat-1p::GFP + dat-1p::CAT-2]. GFP expression in CEP, ADE and PDE neurons. From integration of baEx33.