Search Strains

Temperature sensitive maternal effect lethal if shifted from 15C to 25C at the L4 and later stages; sterile if it gets past embryogenesis before being shifted. Maintain at 15C. MJ61 contains a lin-12 allele (ar170) which results in 2 anchor cells. GS1369 was derived by outcrossing MJ61 to remove ar170. Do not distribute this strain; other labs should request it from the CGC. Added 10/2005: Zhuoyu Ni in Sylvia Lee's lab did not find the published missense mutation in this strain. It does have the ts sterile/lethal phenotype still.

Animals with the duplication are WT and segregate WT and larval lethals. Larval muscle detachment and arrest at about L1 stage in mua-3(ar62) homozygotes. Do not distribute this strain; other labs should request it from the CGC.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.

uzEx22 [ets-4p::GFP + pha-1(+)]. Maintain at 25 C. Non-transgenic animals are temperature-sensitive lethal. Reference: Thyagarajan et al. PLoS Genet. 2010 Sep 16;6(9). pii: e1001125.

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

CRISPR-engineered whole-gene deletion of lin-65. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265

1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.

Isolated from a deletion library.

Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305.

No obvious phenotype. C. elegans tdp-1 coding sequences were completely removed and replaced with sequences encoding human TDP43 optimized for expression in C. elegans. Three synthetic introns are introduced into the humanized locus. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305.

Deletion allele generated by the Mitani Lab.

Extremely prolonged lethargus and increased movement quiescence during lethargus. A little bit slow growing.

Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.

Complete lack of behavioral quiescence during sleep. References: Turek et al. Current Biology, 2013, 23, 2215-2223. Turek et al. eLife 2016;5:e12499.

syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Complete lack of behavioral quiescence during sleep. Reference: Turek et al. Current Biology, 2013, 23, 2215-2223.

goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.

goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.

Complete lack of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.

Temperature sensitive embryonic lethal mutation with defects in centration and rotation of the centrosome pronuclear complex in the first cell division. Maintain at 15C.

Sid. Deletion allele. Reference: Whangbo JS, et al. G3 (Bethesda). 2017 Oct 12 [Epub ahead of print]. pii: g3.300308.2017. doi: 10.1534/g3.117.300308. PMID: 29025917.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.

Heterozygotes are WT and segregate WT, dead eggs, and Lon males. nhr-25 is homozygous embryonic lethal.

cshIs140 [rps-28p::TIR1(F79G)::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Ubiquitously expressed single copy, modified TIR1 allele, TIR1(F79G) that is compatible with 5-PH-IAA and can be used to deplete auxin-induced degradation-tagged (AID-tagged) proteins. Efficiently depletes target proteins at 1 µM 5-Ph-IAA. Nuclear localized mCherry co-expression marker. Reference: Hills-Muckey et al. Genetics. 2022 Feb 4;220(2):iyab174. doi: 10.1093/genetics/iyab174. PMID: 34739048.

Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.

sos-1 gain-of-function allele originally isolated as a suppressor of sem-5(n1619) lethality. pd10 causes a E99K substitution within the N-terminal histone fold domain of SOS-1. Single mutants appear wild-type.

sos-1(pd9) is a gain-of-function allele causing a C662Y substitution within the Ras exchange motif of SOS-1. Originally isolated as a suppressor of sem-5(n1619) lethality. Single mutants appear wild-type. Reference: Wooller A & Hopper N. (2014) European Worm Meeting. (Anyone using this allele may cite Neil Hopper as a personal communication based on this meeting abstract.)

Dominant temperature sensitive maternal-effect embryonic lethal. Maintain at 15C. Heterozygotes are WT. hIn1 homozygotes are Unc. Early cleavage spindles small and misoriented, cytokinesis often incomplete. Recessive non-temperature sensitive maternal-effect embryonic lethal (but sterile in conjuction with unc-59).

Heterozygotes are WT. ct46 is a dominant, temperature sensitive maternal effect lethal. ct46 homozygotes are viable and fertile at 15C. b284 is a non-conditional, recessive maternal effect lethal. Heterozygotes give more viable progeny at 15C than 25C.

ct61 is a dominant, temperature sensitive, maternal effect lethal. sb4 is a revertant of the dominant phenotype. sb4 is a recessive, temperature sensitive, maternal effect lethal with approx. 10% hatching at 15C and 0% at 25C.

Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.

Dpy. Maternal effect persistent cell corpses. This was derived from MT4993; it was outcrossed once to get rid of an unlinked lethal. Hatching rate has improved from 10-70% to 98%.

Dominant temperature sensitive maternal effect lethal. Will segregate some Vab. Maintain at 15C: about 30% of homozygotes hatch at 15C. Will not grow at 20C or 25C. Unc.

5-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/

2-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/

49-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/

This strain can grow at 11.5C but is embryonic lethal at 15C and above. Temperature shifts in late embryogenesis or in larval stages result in defects in many asymmetric cell divisions in postembryonic develoment.

1.6 kb deletion in msi-1. Males have poor mating efficiency.

1.6 kb deletion in msi-1. Males have poor mating efficiency.

Egl, Pvul, Psa (Phasmid Socket Absent) and some embryonic lethality. The T cell division can be symmetric as in lin-17 mutants. Less severe at 15C. swsn-4 encodes a homolog of yeast SW12, a component of the SWI/SNF complex.

Temperature sensitive. At 22.5C, maternal effect embryonic lethal. Temperature shift-up to 22.5C during embryogenesis results in animals with Egl, Pvul and Psa (phasmid socket absent) phenotypes. Shift-up to 25C results in growth arrest at larval stage. The T cell division can be symmetric as in lin-17 mutants. At 15C, nearly WT. Males grown at 15C can mate very well. psa-1 encodes a homolog of yeast SW13, a component of the SWI/SNF complex. Sequence data of this strain revealed the mutation is actually GTC/CCC/TCA to GTC/CTC/TCA causing a P86L substitution (G. Hayes).

T14G8.1 Deletion of 2018 bp of T14G8.1 [nucleotide 3699 (in exon 4) joined to 1682 (in exon 6)]. No phenotype observed.

Cold sensitive embryonic lethal. 95% viable at 24C, 3.7% viable at 15C. 43% symmetric 2-cell. Osmotically senstive (thus requires lineage in osmotically conditioned media, such as 0.8X egg salt).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-4(or344).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-5(ye121).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 24C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2..