| MH1955 |
C. elegans |
nhr-25(ku217) X. Show Description
Temperature sensitive Egl.
|
|
| HL2000 |
C. elegans |
+/szT1 [lon-2(e678)] I; nhr-25(jm2389)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and Lon males. nhr-25 is homozygous embryonic lethal.
|
|
| VC469 |
C. elegans |
+/szT1 [lon-2(e678)] I; nhr-25(ok645)/szT1 X. Show Description
F11C1.6. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok645 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| KRY84 |
C. elegans |
nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-25 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| KRY85 |
C. elegans |
ieSi57 II; nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| OP33 |
C. elegans |
unc-119(ed3) III; wgIs33. Show Description
wgIs33 [nhr-25::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP356 |
C. elegans |
unc-119(ed3) III; wgIs356. Show Description
wgIs356 [nhr-25::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| RW10348 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10318. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10318 [nhr-25::TGF(3H4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RG3560 |
C. elegans |
nhr-256(ve1060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 4160 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgtttCTATAATTTTCTTTGATTATTCAA ; Right flanking sequence: AGGATAATGTTGAACTACAAGAAAAAAGAG. nhr-256 crRNA A: GATGTCTCGTGGGAATTGCA; nhr-256 crRNA B: GAATCGTGGATTTCGGCTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC1654 |
C. elegans |
nhr-259(gk792) I. Show Description
C27C7.8. External left primer: TCCAAAATTCTCGTTCGGAG. External right primer: TCGACTTACCTCTGACCGCT. Internal left primer: TTCGGAATTTCTGTCCGAAG. Internal right primer: GTCGATGCACCAATGTTGAC. Internal WT amplicon: 2373 bp. Deletion size: 1439 bp. Deletion left flank: AAAAGGTTGGTAGTCGTCGGGAAATATATA. Deletion right flank: CCCACGAACCCACAATCACCATCCGCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|