Search Strains

dzDf3 [I:1999831 - 2100118 deleted]. Heterozygotes are wild-type GFP+. Segregate wild-type GFP+, dead eggs, and GFP+ Lon males.

T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu

At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Dpy, mCherry pharyngeal muscle, dim GFP+ in coelomycytes. Insertion/deletion into cxTi10882 MosSCI site on Chr. IV. Can be used as balancer.

Aldicarb resistant. This allele is a small exonic deletion that frameshifts exon 21, thus deleting the MUN domain of both long and short isoforms of unc-13. The reference allele e51 is R471-stop, affecting only UNC-13L. Derived by 2x outcross of BC168. Reference: Rose AM & Baillie DL. Genetics. 1980 Nov;96(3):639-48.

Crispr/Cas9 engineered mutation in unc-119. ox819 is an 11 bp deletion causing a frameshift after V110 (UNC-119a) and then appends 29 out-of-frame amino acids before a stop codon. unc-119(ox819) animals are phenotypically identical to unc-119(ed3) animals and can be rescued by expression of the smaller C. briggsae unc-119 gene (Cbr-unc-119). Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] Reference: Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.

bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91.

NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.

cldIs5 [pie-1p::capg-1::GFP + unc-119(+)]. GFP tagged CAPG-1 driven by the pie-1 promoter; expression is detected in the germline and in embryos. References: Collette K, et al. J Cell Sci. 2011 Nov 1;124(Pt 21):3684-94. Bembenek JN, et al. Curr Biol. 2013 Jun 3;23(11):937-46.

M01G12.12. External left primer: GAGTGGTGGGCAATTGAGTT. External right primer: CCACCCAAGATCTGGTCAGT. Internal left primer: TGTCAACTTGAGGATCGACG. Internal right primer: ATTCCTGCAATTGGTCAAGG. Internal WT amplicon: 2509 bp. Deletion size: 979 bp. Deletion left flank: ATTTTCAACGAAAGTTTTTCGGTTATTTCA. Deletion right flank: AGAGGAAAAAATACGGACAAGAAGAATAAT.

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om129 homozygotes (reduced fertility, maternal effect embryonic lethality, and high incidence of male offspring). om129 homozygote defects become more severe over successive generations and are more severe at 25C. om129 is a CRISPR-engineered deletion completely removing cid-1 and pup-2 loci. cid-1 also known as pup-1. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539. Superficially wildtype strain expresses GFP in the pharynx and segregates GFP+ dumpy sterile qC1 homozygotes and homozygous pup-1/-2(om129) animals that have reduced fertility and maternal effect embryonic lethality and are Him. Phenotype becomes more severe over successive generations and is more severe at 25°C. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.

ubr-5(om2) is a deletion predicted to severely truncate the UBR-5 protein. ubr-1 also known as sog-1. Reference: Safdar K, et al. G3 (Bethesda). 2016 Jul 7;6(7):2125-34. doi: 10.1534/g3.116.027805. PMID: 27185398.

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP non-GFP smrc-1(om138) met-2(n4256) homozygotes (reduced fertility, reduced embryonic lethality, and produce a high frequency of male offspring). These phenotypes are more severe at 25C, and at 25C the subsequent M-Z- generation produces essentially no viable embryos. The smrc-1(om138) allele was generated with CRISPR/Cas9 on the met-2(n4256) chromosome. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.

pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om140 is a CRISPR-engineered internal deletion removing most of the pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.

pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om141 is a CRISPR-engineered deletion removing the entire pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.

Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx38) results in embryonic arrest during morphogenesis.

Temperature sensitive. Missing Ray. Swollen tail and reduced fan. Temperature sensitive lethal at all stages. Wrinkled spicule.

Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Slightly shorter than WT. mab-21(bx53)/yDf10 is embryonically lethal with embryo arrest at 2 fold stage.

Conditional lethal: inviable when grown at 25C. Wild type at 16C. Viable when grown at 20C; partial ray loss at 20C. Shifting males during ray assembly to non-permissive temperature results in ray loss. No lineage defect.

Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx83) results in embryonic arrest during morphogenesis.

Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate. tlp-1 encodes a nuclear protein with a single C2H2-type zinc finger domain and an N-terminal "SPLALLA" domain, similar to that of Sp1 transcription factors of vertebrates. The bx85 mutation involves a truncation of TLP-1 due to a frameshift caused by a 5-bp deletion.

Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. AID* and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX6035 with CA1200. Reference: Cahoon CK, Libuda DE. Conditional immobilization for live imaging Caenorhabditis elegans using auxin-dependent protein depletion. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506.

Full CRISPR deletion of rcs-1 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

jy110 is a CRISPR-engineered deletion removing the entire drh-1 coding sequence. Susceptible to viral infection. Defective in inducing the intracellular pathogen response upon viral infection. Reference: Sowa JN, et al. J Virol. 2020 Jan 6;94(2):e01173-19. doi: 10.1128/JVI.01173-19. PMID: 31619561.

Full CRISPR deletion of fbxa-75 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

Full CRISPR deletion of fbxa-158 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

C30G12.1 Homozygous. No overt morphological or behavioral abnormalities. 1286 bp deletion. The region of cosmid C30G12 that is deleted is 39,238 - 40,523 bps (inclusive). The deletion includes an ectopic 5 bp sequence, GGTTA. The sequence crossing the deletion for ok910 is: ....GCCATGGTTAAAAGT GGTTA AAAAATTCAGTATAT... This deletion was generated by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publication resulting from its use. http://www.mutantfactory.ouhsc.edu/

Temperature sensitive, embryonic lethal mutant. 98% of embryos produced by homoygous mothers hatch at 15C; 0% produced at 26C hatch (but some viability at 25C). Mutation is recessive at 26C. First mitotic spindle in one-cell zygote is mis-positioned, often abnormally near the posterior pole; some chromosome segregation defects.

Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.

Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. Throws males. or295 is a gga to aga substitution (G16R).

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Embryonic lethal at restrictive temperature of 26C; viable embryos at permissive temperature of 15C. [NOTE: PCR detection of or574 can be difficult. gpr-1 and gpr-2 paralogues are closely linked and 97% identical in DNA sequence.] Reference: Couwenbergs C, et al. J Cell Biol. 2007 Oct 8;179(1):15-22.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. apo-5(or358) is temperature-sensitive embryonic lethal. 100% dead embryos when L4 larvae are shifted to 26.6C. A small percentage of embryos survive form L4 larvae shifted to 25-26C. or358 appears to be semi-dominant; L4 or358/+ heterozygotes shifted to 26C produce ~20% embryonic lethality. Maintain at 15C. References: Encalada SE, et al., Mol Biol Cell. 2005 Mar;16(3):1056-70. Strome S, et al. Mol Biol Cell. 2001 Jun;12(6):1751-64.

Semi-dominant. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.

Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.

Strongly semi-dominant, temperature sensitive, embryonic lethal mutant. 40% of embyros produced by homozygous mothers at 15C will hatch; 0% produced at 26C will hatch. Mutation is semi-dominant at 26C: 85% of embyros produced by heterozygous mothers hatched at 26C. Mutant embryos exhibit excess coritical actomyosin contractility (extra furrows and protrusions) in early embryonic cells; during interphase and most of mitosis. or621 is a tcc to gcc substitution (S15A).

Strongly semi-dominant, temperature sensitive, embryonic lethal mutant. 40% of embyros produced by homozygous mothers at 15C will hatch; 0% produced at 26C will hatch. Mutation is semi-dominant at 26C: 85% of embyros produced by heterozygous mothers hatched at 26C. Mutant embryos exhibit excess coritical actomyosin contractility (extra furrows and protrusions) in early embryonic cells; during interphase and most of mitosis. Throws males. or621 is a tcc to gcc substitution (S15A).

Maintain at 15C. Temperature-sensitive embryonic lethal with cytokinesis defects. Reference: Canman JC, et al. Science. 2008 Dec 5;322(5907):1543-6.

Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.

Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.

Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. or295 is a gga to aga substitution (G16R).

Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exon and extending beyond the 3' UTR.

Temperature-sensitive embryonic lethal. Maintain at 15 degrees. 100% dead embryos at 25 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.

Temperature-sensitive embryonic lethal. Maintain at 15 degrees. 100% dead embryos at 25 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.

Temperature-sensitive Sterile and Embryonic lethal. Maintain at 15C. Homozygous or749 L4 larvae shifted to 25C become fertile adults that produce embryos with a late cytokinesis defect after the first embryonic mitosis. Reference: Canman JC, et al. Science. 2008 Dec 5;322(5907):1543-6.

Temperature sensitive embryonic lethal/sterile. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.