Strain Information
| Name | HBR1971 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | nlp-42(syb235) V. |
| Description | Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2x |
| Made by | SunyBiotech Corperation |
| Laboratory | HBR |
| Reference | Not published. |
Sign in
or
register an account if you want to order this strain.