Search Strains

Heterozygotes are WT and segregate WT, Dpy Steriles, and Uncs which are Mel with over 99% embryonic lethality.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1496 homozygotes that do not produce viable progeny. GE2277 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT, Dpy Steriles, and embryonic lethals. Throws males. t1478 PKA arm-5.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1559 homozygotes that produce arrested embryos. GE2399 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Wild type at 15C. Embryonic lethal at 25C. Temperature sensitive phase during embryogenesis. sup-35 mutations may (and have) occurred spontaneously in this strain. This can be checked by shifting the worms to 25C: pha-1 animals should be dead while sup-35 pha-1 animals will live.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1674 homozygotes that do not produce viable progeny. GE2605 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1587 homozygotes that produce arrested embryos. GE2621 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1693 homozygotes that do not produce viable progeny. GE2666 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Wild type at 15C. Maternal effect embryonic lethal at 25C. Temperature sensitive period in oocyte and early embryogenesis.

sup-37 suppresses temperature sensitive embryonic lethality of e2123. Strain is viable at 15C and 25C. Dpy. Behavioural mutation leading to avoidance of bacteria (worms tend to concentrate just outside the lawn) unlinked to sup-37.

sup-36 suppresses temperature sensitive lethal phenotype of e2123. Strain is viable at 15C and 25C. Dpy.

sup-35 suppresses the temperature sensitive embryonic lethality of e2123. Strain is viable at 15C and 25C. Dpy.

Heterozygotes are WT and segregate WT, Dpy Steriles, and Uncs which are Mel with over 99% embryonic lethality.

Temperature sensitive. Maintain at 15C. pha-1(e2123) is embryonic lethal at 25C. Hermaphrodites have an abnormal tail: sometimes twisted, tail whip never formed, often bobbed; sometimes uncoordinated with bent tail. Adult male tail deformed also.

Dpy. cib-1 is a temperature sensitive maternal effect lethal. Grow at 15C. Produces dead eggs at 25C.

dgEx66 [(pAMS58) vha-6p::Q82::YFP + rol-6(su1006) + pBluescript II]. Maintain by picking Rollers. Q82::YFP is completely aggregated throughout the intestine.

dgEx83[pAMS56 vha-6p::Q64::YFP + rol-6(su1006) + pBluescript II]. Maintain by picking Rollers. Q64::YFP is completely aggregated throughout the intestine.

Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C. Grows at 20C.

Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C. Some growth at 20C.

Temperature sensitive. Maintain at 15C. Embryonic lethal.(Some growth at 20C.) [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]

ts embryonic lethal. Grows at 15C.

Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C.

Class I allele. Complete loss of gut granules (birefringence) in intestinal cells and mislocalization of birefringent material into the intestinal lumen. Reference: Rabbitts et al. (2008) Genetics 180:857-871.

WT strain. cd8 will suppress the embryonic and larval lethality of cup-5(zu223).

Temperature-sensitive sterile; maintain at 15-20C. uae1 is a CRISPR-engineered deletion of the mip-1 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833.

Temperature-sensitive sterile; maintain at 15-20C. uae2 is a CRISPR-engineered deletion of the mip-2 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.

Slow growing and not completely viable.

mnIs17 [osm-6::GFP + unc-36(+)]. cas530 is a 641 bp deletion introduced by Cas9-triggered germ line knockout. Deletion left flank: ATGAAGCAAACGAG; deletion right flank: TAAAAAGGAAAGGATAGATGC. Lipophilic dye filling and morphology and IFT of amphid and phasmid cilia are superficially wild type.

mnIs17 [osm-6::GFP + unc-36(+)]. Lipophilic dye filling is 100% defective and the amphid and phasmid sensory cilia are severely shortened with strong IFT particle accumulation. cas531 is a 612 bp deletion introduced by Cas9-triggered germ line knockout. Deletion left flank: ATGAAGCAAACGAGCCAG; deletion right flank: TCTTCAATTCTCTCGAGT.

GFP inserted into the endogenous che-3 locuse at its N-terminus and 659 bp in-frame deletion introduced by Cas9-triggered genome editing. Deletion left flank: TTGGTTAGTGATATCTCAAG; deletion right flank: ATGGGCATCAATCAATGAT. Weak green fluorescence in the cell bodies of ciliated neurons but not in the amphid or phasmid cilia. Lipophilic dye filling is 100% defective.

Endogenous spc-1 locus tagged with GFP at C-terminus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

GFP inserted at the N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

unc-70(cas983) removes nine amino acids (H590-L598) in the SCA5-associated deletion in β-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

L268P mutation introduced in α-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

7×GFP11 tag inserted into the C-terminus of the endogenous spc-1 locus by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

L268P mutation introduced in GFP-tagged α-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in β-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

Mutation resulted from the imprecise loss of pk37::Tc1. Incompletely penetrant sterile and lethal. Defects in oocyte cell cycle arrest, gonad migration, and hypodermal differentiation. See also WBPaper00002965.

Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.

mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.

mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.

mgDf90 completely eliminates the daf-3 coding region.

Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.

Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.

Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.

CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806

Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.

Him, some $ embryonic lethal, slightly eri, abnormal shapes of gut nuclei