Search Strains

This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

cshIs128 [rps-28p::TIR1::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Companion strain to HML1012. Harbors conventional allele of TIR1 and Nuclear localized mCherry co-expression marker.

Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.

sbEx136 [(pAW33.1) let-502p::GFP + rol-6(su1006)]. pAW33.1 is about 6.6 kb BamH1 fragment from K06G1 and includes the first 12 amino acids of LET-502 clones into pPD95.67/BamH1. Should be nuclear localized, but is not nuclear localized. Maintain by picking Rollers.

Dominant temperature sensitive maternal effect lethal. Will segregate some Vab. Maintain at 15C: about 30% of homozygotes hatch at 15C. Will not grow at 20C or 25C. Unc.

This strain can grow at 11.5C but is embryonic lethal at 15C and above. Temperature shifts in late embryogenesis or in larval stages result in defects in many asymmetric cell divisions in postembryonic develoment.

lpIs32 [ftt-2::gfp + rol-6]. Rollers. FTT-2::GFP is expressed strongly in the pharynx, and can be observed in the neurons in the head, body and tail, and also weakly expressed in the intestine. Reference: Wang Y, et al. Mech Ageing Dev. 2006 Sep;127(9):741-7. PMID: 16860373.

bpIs37 [dcap-1p::dcap-1::DsRed + rol-6(su1006)]. Rollers. Translational DsRed reporter for the P body-specific marker dcap-1, which encodes the C. elegans ortholog of decapping complex component DCAP1. Low levels of expression are homogenously distributed in the cytoplasm at all stages of embryogenesis. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.

bpIs90 [tia-1p::tia-1::GFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. TIA-1::GFP is homogenously distributed in the cytoplasm during embryogenesis. At larval stages, diffuse TIA-1::GFP signals are observed in seam cells and hypodermal cells. TIA-1::GFP forms distinct bodies, especially in seam cells and hypodermal cells, under stress conditions. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.

The maintenance of neuronal cell body positions is abnormal.

The maintenance of neuronal cell body positions is abnormal.

The maintenance of neuronal cell body positions is abnormal.

npr-1(ur89) has clumping, hyperactive, and bordering phenotypes.

kpIs100 [pie-1p::Ub(G76V)::GFP::H2B::drp-1 3' UTR + unc-119(+)]. [NOTE: (4/4/2025): Strain segregates Rol, and non-Rol, possibly due to a background dpy-10 mutation; both express GFP as expected. It was recommended that non-Rollers be picked when maintaining the strain.] Expresses Ubiquitin::GFP fusion protein in the germ line. The last amino acid of ubiquitin is mutated to valine (G76V), which prevents the cleavage of ubiquitin from GFP by the deubiqutinating enzymes and renders the GFP constitutively targeted for degradation by the proteasome. The strain can be used to assay proteasome activity in the germ line. Reference: Kumar GA & Subramaniam K. Development. 2018 Mar 29;145(7):dev163949. PMID: 29540500

ufIs104 [nlp-12(+) + lgc-11p::GFP]. ufIs104 contains a 1.76 kb PCR product containing the nlp-12 genomic locus (−354 bp to +1407 bp relative to the transcriptional start). Over-expression of nlp-12 results in increased body bend amplitude. This strain has a high rate of sterility but can be successfully maintained as a homozygote. Reference: Bhattacharya R, et al. PLoS Genet. 2014 Aug 28;10(8):e1004584. doi: 10.1371/journal.pgen.1004584. PMID: 25167143.

egl-27(we3) animals have variable body morphology defects with cold sensitive embryonic/L1 lethality (5% die at 22C, 90% at 15C). Maternal effect vab-7(ed6) enhancer; semi-lethal with vab-7(ed6).

tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. Maintain at 20-25C. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.

tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Maintain at 20-25C. Derived by crossing JBL1 and TH27. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.

tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Maintain at 20-25C. Derived by crossing JBL1 and JH2108. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.

Starved; feeding defective; lacks M3 neurotransmission. From DA1051. DA1051 has bor-1 in the background. bor-1 has been crossed out in JD105.

wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140

wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140

Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801593-13807217) and insertion of ATTTGTTCAGACAATAAGCTNGAAATC. No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801629-13807223). No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.

P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

meGFP tag inserted at C-terminus of endogenous mut-16 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

ax4544 is a CRISPR-engineered null mutant of npp-12. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

mNeonGreen tag inserted at N-terminus of endogenous imb-1 locus. Expressed in all tissues. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

wrmScarlet tag inserted at C-terminus of endogenous nucl-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

AID*::3xFLAG tags inserted at C-terminus of endogenous npp-11 locus. AID* is a minimal AID construct of 44 amino acids (https://academic.oup.com/genetics/article/217/3/iyab006/6104563). Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

ax4587 is a CRISPR-engineered deletion removing the FGG repeats of GLH-1. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

wrmScarlet tag inserted at C-terminus of endogenous car-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

hmp-2(zu364) homozygotes are 99% embryonic or L1 lethal due to a defect in embryonic body elongation; approximately 1% survive to adult stages. Well balanced by hIn1. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Hmr inviable embyros and Egl Unc. Hmr: Hammerhead - defective hypodermal enclosure, especially in anterior regions; approximately 2% of zu389 embryos enclose normally and are Hmp [Humpback: defective body elongation, abnormal bulges on dorsal side]. See also WBPaper00005031. Received new stock from Allison Lynch in the Hardin lab 3/2009.

Heterozygotes are WT. Embryos from unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.

Heterozygotes are WT. Embryos from mex-6; unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.

zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Transgenic PAR-3 is subject to ZIF-1-dependent degradation. GFP-tagged PAR-3 is degraded in early embryonic somatic cells. Worms carrying the transgene are non-Unc and express GFP very weakly in early embryos (only detectable by antibody staining), and later in adherens junctions of epithelial cells.

Heterozygotes are WT and segregate WT, Hmp inviable embyros (Hmp: humpback-defective body elongation, abnormal bulges on dorsal side) and Daf Sma (ts Daf).

qEx319 [lag-2::cMyc + rol-6(su1006)].  Rollers.  Extrachromosomal array carrying myc-tagged LAG-2 protein partially rescues lag-2(null).  About 70% of progeny are Lag.  Survivors are Rollers.  Reference: Crittenden et al., Mol Biol Cell. 2006 Jul;17(7):3051-61.

Temperature-sensitive allele of cyd-1. Phenotypically wild-type at 15C. At 25C, approximately one-third of q626 hermaphrodites were missing one distal tip cell (DTC) and approximately one-half of q626 males were missing the linker cell (LC). q626 also feminizes the XO gonad. q626 affects the production of SGP daughters in both sexes. There is also a maternal component since the mutant phenotype is almost fully penetrant in offspring of homozygous mothers, but less penetrant in offspring of heterozygous mothers. Reference: Tilmann C & Kimble J. Dev Cell. 2005 Oct;9(4):489-99.

Low percent sterile, more sperm than WT, delayed oogenesis, larger broods than WT. PCR amplify: WT band is about 3 kb, deletion band is about 1.2 kb. Oligos used: outer: 201A and 202S; inner: 203A and 204S. Do not distribute this strain; other labs should request it from the CGC.

Unc. About 20% have single gonad arm. Do not distribute this strain; other labs should request it from the CGC.

Rollers. About 15% have a one-armed gonad or are WP. Do not distribute this strain; other labs should request it from the CGC.

T05C12.6, T05C12.7. Heterozygotes are WT and GFP+ in the pharynx. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy and GFP+ in the pharynx. Homozygous mig-5&cct-1(ok280) worms arrest at about L2/L3. Strong loss of function for cct-1 and weak for mig-5. mig-5 is a dishelved homologue. External left primer: CGGCCTAAACGTTGATTGTT. External right primer: CAGAGTGAGTCGTGAACCGA. Internal left primer: TAATCCTGAATCCGGACGAG. Internal right primer: TACGAGATTTCGGTCCCTTG. Internal WT amplicon: 3284 bp. Deletion size: 987 bp. Deletion left flank: GCTGCAGTCTGATGTGCATGGCGGCTCCAT. Deletion right flank: TTGGTGTTGTCTATGCTTCAAGAAAATTGA. Do not distribute this strain; other labs should request it from the CGC.

q740 homozygotes throw about 50% gonadogenesis defective worms (can be gonadless or have a single arm gonad). Do not distribute this strain; other labs should request it from the CGC.

To maintain, check individual fertile worms for both Sep and Fog offspring. sep-1 homozygotes are sterile at 20C and 25C (Sterile and Unc at 25C), and mostly normal at 15C. fog-1; fbf-1 fbf-2 homozygotes have small germ lines and are often Muv. Best to maintain at 25C for scoring. Do not distribute this strain; other labs should request it from the CGC.

Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC.

Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. gld-1(q361) is a missense allele but phenotypically null, which allows the detection of gld-1 mRNA and protein by single molecule FISH or antibody staining. Reference: Hansen et al (2004) Dev. Biol. 2004;268(2):342-57. Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.

qSi44 [glp-1::6xMyc6xHis + Cbr-unc-119(+)] II. Homozygous viable. Variable body length. May still carry unc-119(ed3) in the background. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271

Maintain at 15C. Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP tra-1(q183) homozygous females. Raise strain at 15C; at 20C many heterozygotes are also feminized. tra-1(q183) is temperature-sensitive for its XX, but not its XO mutant phenotype. At 25C, both q183/q183 and q183/+ are female. At 15C, q183/q183 is still always female, but q183/+ can be hermaphroditic. Maintain by picking fertile GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies.