More Fields
Strain Species Genotype
GR1823 C. elegans mut-16(mg461) I. Show Description
RNAi-deficient in soma. Reference: Zhang C, et al. Proc Natl Acad Sci U S A. 2011 Jan 25;108(4):1201-8.
NL1800 C. elegans mut-16(pk700) I. Show Description
NL1810 C. elegans mut-16(pk710) I. Show Description
YY1492 C. elegans mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
JK3826 C. elegans mut-16(mg461) I; larp-1(q783) III. Show Description
Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GR1748 C. elegans unc-119(ed3) III; mgSi2 IV. Show Description
mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
JK4545 C. elegans larp-1(q783) III. Show Description
Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
YY470 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.