Search Strains

Heterozygotes are WT and segregate WT and Uncs. The Uncs have a non-conditional maternal-effect embryonic lethal phenotype: the E blastomere adopts MS fate in about 5% of mutant embryos. The Uncs are 100% penetrant for embyronic lethality and morphogenesis defects.

Temperature-sensitive, embryonic-lethal mutant that lacks a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). About 100% of embryos produced by homozygous mothers hatch at 15C; 0% hatch at 26C. ZEN-4 = vertebrate MKLP1 kinesin. There are two mis-sense mutations present in zen-4(or153). One is a D520N (GAC to AAC) and the other is D735N (GAT to AAT). Whether one or both is responsible for the phenotype is not know. Maintain at 15C. Shift L4s to 26 overnight to observe mutant phenotype on embyros produced by adults.

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

Heterozygotes are Unc and segregate Uncs, WT which give only dead eggs, and dead eggs. or309 is a deletion allele: removes exon 4 to 3' end and leave about 100 N-terminal amino acids.

efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).

efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3′UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644

Larger body size, longer lifespan, egg-laying defect, male tail abnormal.

Larger body size, longer lifespan, egg-laying defect, male tail abnormal.

Larger body size, longer lifespan, egg-laying defect, male tail abnormal.

Made by crossing MT3353 egl-15(n484) sma-5(n678) with N2 males and selecting animals that grew much better. FK312 probably only carries the sma-5(n678) mutation but that has not been confirmed by sequencing. Small body size, slow growth, abnormal intestinal granules, shorter lifespan than WT.

Very small. Small brood size (about 1/10 that of WT). Grows very slowly. Reference: Watanabe, N et al. Genes to Cells 2007. 12(5):603-609.

Very small. Small brood size (about 1/10 that of WT). Grows very slowly. Line A. Reference: Watanabe, N et al. Genes to Cells 2007. 12(5):603-609.

Very small. Small brood size (about 1/10 that of WT). Grows very slowly. Line C. Reference: Watanabe, N et al. Genes to Cells 2007. 12(5):603-609.

Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-98. Phenotype (needles and accumulations of paramyosin) is suppressed by growth at 15C or by starvation.

Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-96.

Adults are Unc - reduced motility; disorganization of myofilament lattice in body wall muscle cells by polarized light microscopy; abnormal accululations of F-actin near muscle cell-cell boundaries.

sfIs21 [myo-3p::PercevalHR + lin-44p::GFP]. Reporter can be used to measure the ATP/ADP ratio in body wall muscle cells. Matsunaga Y, et al. Commun Biol. 2024 Oct 17;7(1):1342. doi: 10.1038/s42003-024-07042-3. PMID: 39420071.

Bacteria. E. coli HT115(DE3) bacterial strain carrying pGC8. pGC8 is a partial cDNA of him-14 (ZK1127.11) cloned into the Timmons and Fire "double T-7 vector" L4440. The source of the cDNA is Yuji Kohara's clone yk240h12. pGC8 was constructed by inserting the 1.65kb KpnI/SacI fragment of the him-14 cDNA (from base pair 1071 to 192 base pairs beyond the stop codon) into the same sites in L4440. HT115(DE3) carrying pGC8 should be selected in the presence of 50 um/ml tetracyline and 100 um/ml ampicillin. Prior to an actual feeding experiment, it can be grown in liquid in the presence of amp alone (no tet) and then seeded onto NGM plates containing amp and 1 mM IPTG. This technique does not work well if the cells are old; therefore, the strain should be seeded onto IPTG-containing plates from a fresh overnight that was grown from a colony on an amp/tet plate. Biosafety Level: BSL-1. For more info see http://www.wormbook.org/wli/wbg17.1p32/

naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.

Temperature sensitive. Maintain at 15C. pha-1(e2123) is embryonic lethal at 25C. Hermaphrodites have an abnormal tail: sometimes twisted, tail whip never formed, often bobbed; sometimes uncoordinated with bent tail. Adult male tail deformed also.

dvIs100 [unc-54p::A-beta-1-42::unc-54 3'-UTR + mtl-2p::GFP]. mtl-2p::GFP produces constitutive expression of GFP in intestinal cells. unc-54p::A-beta-1-42 expresses full-length human A-beta-1-42 peptide in bodywall muscle cells that aggregates in vivo. Shifting L4 or young adult animals from 20C to 25C causes paralysis. Reference: McColl G, et al. Mol Neurodegener. 2012 Nov 21;7:57.

pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.

Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

GFP inserted into the endogenous ift-74 locus at the C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not, all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

Animals with the duplication are WT and segregate WT and larval lethals. Larval muscle detachment and arrest at about L1 stage in mua-3(ar62) homozygotes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Coelomocyte endocytosis defect. GFP accumulates in body cavity. MTM-9=Y39H10A.3 mtm-9 pka cup-10. Do not distribute this strain; other labs should request it from the CGC.

ar200 does not display any apparent phenotype. It suppresses the Egl defect of both sel-12(ar171) and sel-12(ar131), and displays genetic interactions with various lin-12 and glp-1 alleles. Do not distribute this strain; other labs should request it from the CGC.

ar205 does not display any apparent phenotype. It suppresses the Egl defect of both sel-12(ar171) and sel-12(ar131). Do not distribute this strain; other labs should request it from the CGC.

aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR] II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST] II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

opIs263 [rpa-1p::rpa-1::YFP + unc-119(+)]. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Express RPA-1::YFP in both germline and somatic tissues. Reference: Padeken J, et al. Genes Dev. 2019 Apr 1;33(7-8):436-451. PMID: 30804228

Caenorhabditis elegans wild isolate. Isolated from soil under a Kiwi fruit tree in a botanical garden in Wuhan City, Hubei Province, China, on Nov 11, 2010. Lat: 30° 32' 34.40" N; Lon: 114° 25' 11.38" E. This strain was whole-genome sequenced as part of the Million Mutation Project (MMP). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

isIs17 [pGZ295 (pie-1p::GFP::pcn-1(W03D2.4)) + pDP#MM051 (unc-119(+))] Maintain at 25C if possible to avoid possible germ line silencing. The entire coding sequence of PCNA (PCN-1, W03D2.4) was PCR-amplified and the resulting fragment cloned into pie-1::GFP germline expression vector to generate pGZ295, which was co-bombarded with pDP#MM051, which carries an unc-119 cDNA. The transgenic line behaves as though the two plasmids have been jointly integrated.

Superficially wild-type at 25C. Can be maintained 15-25C. rt448 is wild-type control strain containing all the silent codon changes used during CRISPR/Cas9 genome editing of sod-1. This strain was back-crossed to remove the edited pha-1 allele used in strain construction. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt448 and is the wild-type control for both G93Ac and G85Rc; rt449 is sod-1[G93Ac] and rt451 is sod-1[G85Rc].

vsIs48 [unc-17::GFP]. Superficially wild-type at 25C. Can be maintained 15-25C, and latent defects observed after oxidative stress. GFP expressed in all cholinergic neurons. rt449 was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation SOD1 G93A. This strain contains additional silent edits in sod-1, and was back-crossed to remove the edited pha-1 allele used in strain construction. The appropriate control is HA2986. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt449, which is sod-1[G93AC], while rt451 is sod-1[G85RC] and rt448 is the wild-type control for both.

Superficially wild-type at 25C. Can be maintained 15-25C, and latent defects observed after oxidative stress. rt451 was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation SOD1 G85R. This strain contains additional silent edits in sod-1, and was back-crossed to remove the edited pha-1 allele used in strain construction. The appropriate control is HA2986. Reference: Baskoylu S, et al. PLOS Genetics (https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007682). NOTE: A micropublication (PMID: 33474528) incorrectly described sod-1 alleles in the text. This strain contains rt451, which is sod-1[G85RC], while rt449 is sod-1[G93AC] and rt448 is the wild-type control for both.

rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.

Bacteria. This strain of E. coli is easier for worms to eat than other E. coli strains. [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Contains a mutation (rpsL20) in a ribosomal subunit gene that confers streptomycin resistance. Biosafety Level: BSL-1.

goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. Reporter expresses the calcium indicator GCaMP3 in all body wall muscles. Reference: Schwarz J, et al. Worm. 2012 Jan 1;1(1):12-4.

hwSi3 [pie-1p::GFP::mex-3::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing full-length MEX-3 uniformly throughout oocytes and early embryos through the 4-cell stage. GFP::MEX-3 then mirrors endogenous MEX-3, disappearing from somatic cells by about the 12-cell stage. Also detected in P granules. GFP::MEX-3 can replace endogenous MEX-3. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

Slow. Slightly Dpy. Recessive. Grows fairly well. Body Muscle abnormal. Sarcomeres faint.

Movement WT. Body muscle abnormal.

Slow moving Unc. Semi-dominant. Body muscle abnormal. Slightly small.

Movement WT. Body muscle abnormal.

Slow moving Unc. Body muscle abnormal. Slightly small.

Semi-paralyzed Unc. Semi-dominant. Body muscle abnormal. Paracrystals.

Paralyzed Unc. Super Slow. Body Muscle Abnormal. Sarcomeres faint.

Unc. Body Muscle Abnormal. Recessive.