Strain Information
| Name | JK3826 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | mut-16(mg461) I; larp-1(q783) III. |
| Description | Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. |
| Mutagen | |
| Outcrossed | x7 |
| Made by | K Nykamp |
| Laboratory | JK |
Sign in
or
register an account if you want to order this strain.