Strain Information
| Name | JK3826 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | mut-16(mg461) I; larp-1(q783) III. |
| Description | Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| Mutagen | No mutagen |
| Outcrossed | x7 |
| Made by | K Nykamp |
| Laboratory | JK |
Sign in
or
register an account if you want to order this strain.