Search Strains

mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. Phenotypic assays have shown that this mNeonGreen tag does not perturb the function of the DAF-2 protein. DAF-2::mNeonGreen is expressed in neurons, XXX cells, vulval cells, germ cells, and oocytes with clear plasma membrane localization as expected for a cell surface receptor. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

mCherry knocked into C terminal of vit-6 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-3 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-1 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https://doi.org/10.1101/2022.06.27.497668

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About four mitoflash events per anterior pharynx per 200 seconds on adult days 2-3 when cultured on standard NGM plates at 20C. In hqIs180 mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About two mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About three mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About six mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

irEx274 [ZK177 + unc-119::CFP + rol-6(su1006)]. Maintain by picking Rollers. Strain throws Rollers (expressing unc-119::CFP), dead eggs, and developmentally-arrrested L1s. Roller is often weak or not apparent. A greater proportion of tbx-35(tm1789) embryos will hatch as inviable L1s at 15C as compared with 20C or 25C.

Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

Multivulva. Amber. No male mating. Not Null.

Egl. Fails to complement daf-14 as well; small deletion or background?? [NOTE: The CGC has received reports that n476 might be heterozygous in this strain. KP2018 is an outcrossed version of this strain and has been confirmed as homozygous for n476.].

Gain of function allele. Small, almost paralyized. Egl. Semi-dominant. daf-C at 27C.

Defects in engulfment, persistent cell coprses observed in embyros, larvae, and adult hermaphrodite gonads. Distal tip cell migration defects.

Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.

Reference: Ceol CJ, Horvitz HR. Dev Cell. 2004 Apr;6(4):563-76.

Slightly Unc. Long irregularly shaped tail. May be Egl. Many hermaphrodites (50%) have single small protrusion posterior to vulva, some gonadal abnormality and sterility.

Vulvaless. Segregates males which mate well.

n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.

Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, Sterile Muv, and males. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. The male phenotype similarly is heat sensitive; only males that are the progeny of lin-13 hermaphrodites and are grown at 20C or 25C have ventral protrusions. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.

Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon.

Superficially WT. Low brood size. Usually bag at day 2-3 of adulthood. 650nt deletion takes out a promoter and an ATG; predicted to be a molecular null.

e1324 is a ts allele - animals are Dpy at 25C. Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture.

Hets are round-nosed Small. n716 is dominant Small, recessive lethal. To maintain strain pick blunt-nosed animals. May have to remove WT progeny to prevent them from taking over.

Abnormal cell death. Cells that normally die survive.

Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.

n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.

vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874.

Dpy. Egl. Abnormal vulval cell lineages.

Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture; temperature sensitive. Unc. Lon.

nIs286 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.

nIs287 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.

nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.

Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.

Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT. Segregates Dpy Sterile and Dpy Unc.

Heterozygotes are WT GFP+. Segregates GFP+ Dpy Sterile and non-GFP Dpy Unc. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.

nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.

nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.

Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

Non-lethal let-60 allele, multivulva phenotype (93% penetrance). Semi-Dominant (17% of hets are Muv). Amber suppressible. Non-null. PKA lin-34. See WBPaper00006902: strain probably carries a side mutation(s) that impairs chemotaxis to the odorant isoamyl alcohol.

nSi3 [set-17p::set-17(+)::GFP::set-17 3’UTR + unc-119(+)] IV. nSi3 expresses a translational fusion of genomic set-17 and GFP. nSi3 rescues the brood size defect of n5017 in this strain. nSi3 is a single copy MOS-mediated transposition into the cxTi10882 site; GFP detectable in the nuclei of the hypoderm, sperm and proximal germline, as well as some other cells. Reference: Engert CG, et al. PLoS Genet. 2018 Apr 27;14(4):e1007295.

Heterozygotes are WT and segregate WT, UncVul and dead eggs. The UncVuls are small, kinky, paralyzed and vulvaless. Maintain by picking WT.

Heterozygotes are WT and segregate WT, UncVul and dead eggs. UncVuls are small, kinky, paralyzed and vulvaless. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs, and VulUnc. VulUncs are small, kinky, paralyzed and vulvaless. Maintain by picking WT.