Strain Information
| Name | MQD2884 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | vit-2(ok3211) vit-1(hq532) X. |
| Description | hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequenceAAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCA CG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCA CG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https://doi.org/10.1101/2022.06.27.497668 |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Chao Zhai |
| Laboratory | MQD |
| Reference | Zhai, C., Zhang, N., Li, X. X., Tan, X. K., Sun, F., & Dong, M. Q. (2022). Immuno-electron microscopy localizes Caenorhabditis elegans vitellogenins along the classic exocytosis route. bioRxiv, 2022-06. |
Sign in
or
register an account if you want to order this strain.