Strain Information
| Name | MSB115 View On Wormbase |
|---|---|
| Species | C elegans |
| Genotype | unc-70(mir6[loxP] mir16[loxP]) V. |
| Description | Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 |
| Mutagen | No mutagen |
| Outcrossed | x1 |
| Made by | Ravi Das |
| Laboratory | MSB |
| Reference | Ravi Das, Li-Chun Lin, Frederic Català-Castro, Nawaphat Malaiwong, Neus Sanfeliu-Cerdán, Montserrat Porta-de-la-Riva, Aleksandra Pidde, Michael Krieg. An asymmetric mechanical code ciphers curvature-dependent proprioceptor activity. Sci Adv. 2021 Sep; 7(38): eabg4617. doi: 10.1126/sciadv.abg4617 |
Sign in
or
register an account if you want to order this strain.