| DG769 |
C. elegans |
unc-32(e189) emb-30(tn476) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
|
|
| KP2018 |
C. elegans |
egl-21(n476) IV. Show Description
Mutation confirmed by Nonet lab.
|
|
| MT1071 |
C. elegans |
egl-21(n476) IV. Show Description
Egl. Fails to complement daf-14 as well; small deletion or background?? [NOTE: The CGC has received reports that n476 might be heterozygous in this strain. KP2018 is an outcrossed version of this strain and has been confirmed as homozygous for n476.].
|
|
| MT15488 |
C. elegans |
lin-35(n4760) I. Show Description
Class B SynMuv. Reduced fertility. Maintain at 20C or cooler. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15517 |
C. elegans |
mir-233(n4761) X. Show Description
Deletion breakpoints are:TTGAAGTTGCTCCGGACAAAAA / GCAGCCATCAGTCT...TCTCTCCAAGGTTGTA / ACAGGAGACGACGACCACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT15981 |
C. elegans |
mir-87(n4104) V; mir-233(n4761) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|