More Fields
Strain Species Genotype
AD294 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
AD296 C. elegans spe-51(syb2737[spe-51::mNeonGreen]) IV; him-5(e1490) V. Show Description
mNeonGreen tag inserted into the endogenous spe-51 locus. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
APL31 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Show Description
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
BN1023 C. elegans bqSi294 II; bqSi1021 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1021 [lin-31p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in P1.p-P11.p and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in P1.p-P11.p can mask GFP::HIS-58 signal. May carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN1029 C. elegans bqSi294 II; bqSi1027 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1027 [unc-122p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in coelomocytes and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in coelomocytes can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN1204 C. elegans bqSi294 II; bqSi1201 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1201 [hlh-12p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the distal tip cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN617 C. elegans bqSi294 II; bqSi614 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi614 [dat-1p::FLP D5::SL2::mNG + unc-119(+)] IV. Heat shock produces green nuclei in dopaminergic neurons and red nuclei elsewhere. Constitutive expression of diffusible mNeonGreen in dopaminergic neurons can mask GFP::HIS-58 signal.
BN711 C. elegans unc-119(ed3) III; bqSi711 IV. Show Description
bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https://doi.org/10.17912/W2G66S
BN854 C. elegans bqSi294 II; bqSi852 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi852 [ckb-3p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the somatic gonad and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the somatic gonad can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN908 C. elegans unc-119(ed9) III; bqSi908 IV. Show Description
bqSi908 [UAS::FLP::SL2::mNG + unc-119(+)] IV. Strain for inducible co-expression of codon-optimised FLP recombinase and fluorescent mNeonGreen by cGAL (GAL4 optimised for C. elegans). Reference: Ayuso C & Askjaer P. Spatiotemporal control of genome recombination through combined FLP-Frt and GAL4-UAS technologies. microPublication Biology. https://doi.org/10.17912/MICROPUB.BIOLOGY.000089.
BN999 C. elegans bqSi294 II; bqSi997 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in intestinal cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in intestinal cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
CZ27593 C. elegans bli-1(ju1789[bli-1::mNG::3xFLAG]) II. Show Description
Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
CZ29114 C. elegans bli-6(ju1914[bli-6::mNG::3xFLAG]) IV. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
DG4218 C. elegans cpg-1(tn1728[mNG::3xflag::cpg-1]) III. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cpg-1 locus. Superficially wild type.
DG4228 C. elegans orc-1(tn1732[mNeonGreen::3xflag::orc-1]) III. Show Description
Superficially wild type
DQM1051 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1066 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1068 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1070 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1072 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DV3208 C. elegans daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
DV3312 C. elegans rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background. Detection with triplex primers: HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’ HS126 5’-TTGTCCTCCTCTCCCTTGG-3’ HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3' Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3327 C. elegans pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3525 C. elegans daf-15(re257[daf-15::mNG::AID]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
FDU1056 C. elegans mig-17(shc19[mig-17::mNG +LoxP]) V. Show Description
C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
GLW16 C. elegans rab-7(utx12[mNG::rab-7]) II. Show Description
Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'
GLW19 C. elegans mpk-1(utx14[mNG::mpk-1]) III. Show Description
Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'
GLW2 C. elegans attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW33 C. elegans T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW35 C. elegans gldi-2(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
GLW39 C. elegans ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
GLW4 C. elegans gyf-1(utx4[gyf-1::mNG]) II. Show Description
Superficially wild-type. C-terminal tag of GYF-1 via CRISPR/Cas9 knock-in of mNeonGreen at gyf-1 locus. Insertion verified by PCR. Left flank: 5' CCATCGGCTCCGGTGAATCCTTCGCGCCGT 3'; Right flank: 5' TAGatgagtcatttctttttccagctttaa 3'. sgRNA: 5' TGACTCATCTAACGGCGCGA 3'
GLW41 C. elegans nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
GLW43 C. elegans edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
GLW45 C. elegans ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
GLW47 C. elegans hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
GLW51 C. elegans cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
GLW57 C. elegans asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
GLW6 C. elegans W08E12.7(utx6[mNG::W08E12.7]) IV. Show Description
Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3'
GLW63 C. elegans pqn-59(utx51[mNG::3xFlag::pqn-59]) I. Show Description
N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3’ (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62.
GLW73 C. elegans H34C03.2(utx55[mNG::3xFlag::H34C03.2]) IV. Show Description
N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3’ (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72.
GLW77 C. elegans jnk-1(utx59[mNG::3xFlag::jnk-1]) IV. Show Description
N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.
GLW8 C. elegans eel-1(utx8[mNG::eel-1]) IV. Show Description
Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'
GLW95 C. elegans F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. Show Description
C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.
GT337 C. elegans aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
JDW389 C. elegans bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Show Description
Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
JDW460 C. elegans noah-1(wrd119[noah-1::linker::mNeonGreen(dpiRNA)::3xFLAG(internal)::linker]) I. Show Description
Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
JH3867 C. elegans bqSi189 II; npp-10(ax4538[mNeonGreen::npp-10]) III. Show Description
bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-10 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans