| AD294 |
C. elegans |
cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
|
|
| AD296 |
C. elegans |
spe-51(syb2737[spe-51::mNeonGreen]) IV; him-5(e1490) V. Show Description
mNeonGreen tag inserted into the endogenous spe-51 locus. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
|
|
| AD316 |
C. elegans |
spe-21(syb4179[spe-21::mNG]) III. Show Description
mNeonGreen tag inserted at the C-terminus of the endogenous spe-21 locus by CRISPR. Expression in the membranous organelles of sperm. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.
|
|
| APL23 |
C. elegans |
ljfSi10 II; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| APL31 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Show Description
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| APL622 |
C. elegans |
ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding
domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| BN1023 |
C. elegans |
bqSi294 II; bqSi1021 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1021 [lin-31p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in P1.p-P11.p and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in P1.p-P11.p can mask GFP::HIS-58 signal. May carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
|
|
| BN1029 |
C. elegans |
bqSi294 II; bqSi1027 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1027 [unc-122p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in coelomocytes and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in coelomocytes can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
|
|
| BN1204 |
C. elegans |
bqSi294 II; bqSi1201 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1201 [hlh-12p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the distal tip cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
|
|
| BN1385 |
C. elegans |
bqSi294 II; bqSi1381 V. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1381 [dat-1p::FLP::SL2::mNG + unc-119(+)] V. Stable expression of FLP in dopaminergic neurons. Heat shock induces GFP expression in nuclei of dopaminergic neurons and red nuclei elsewhere. Constitutive expression of diffusible mNeonGreen in dopaminergic neurons can mask GFP::HIS-58 signal. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Fragoso-Luna A, et al. Genetics. 223(1). doi: 10.1093/genetics/iyac166. PMID: 36321973.
|
|
| BN617 |
C. elegans |
bqSi294 II; bqSi614 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi614 [dat-1p::FLP D5::SL2::mNG + unc-119(+)] IV. Heat shock produces green nuclei in dopaminergic neurons and red nuclei elsewhere. Constitutive expression of diffusible mNeonGreen in dopaminergic neurons can mask GFP::HIS-58 signal.
|
|
| BN711 |
C. elegans |
unc-119(ed3) III; bqSi711 IV. Show Description
bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https://doi.org/10.17912/W2G66S
|
|
| BN854 |
C. elegans |
bqSi294 II; bqSi852 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi852 [ckb-3p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the somatic gonad and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the somatic gonad can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
|
|
| BN908 |
C. elegans |
unc-119(ed9) III; bqSi908 IV. Show Description
bqSi908 [UAS::FLP::SL2::mNG + unc-119(+)] IV. Strain for inducible co-expression of codon-optimised FLP recombinase and fluorescent mNeonGreen by cGAL (GAL4 optimised for C. elegans). Reference: Ayuso C & Askjaer P. Spatiotemporal control of genome recombination through combined FLP-Frt and GAL4-UAS technologies. microPublication Biology. https://doi.org/10.17912/MICROPUB.BIOLOGY.000089.
|
|
| BN999 |
C. elegans |
bqSi294 II; bqSi997 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in intestinal cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in intestinal cells can mask GFP::HIS-58 signal. Might still carry unc-119(ed9) in background. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
|
|
| CZ27593 |
C. elegans |
bli-1(ju1789[bli-1::mNG::3xFLAG]) II. Show Description
Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
| CZ29114 |
C. elegans |
bli-6(ju1914[bli-6::mNG::3xFLAG]) IV. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
| DG4218 |
C. elegans |
cpg-1(tn1728[mNG::3xflag::cpg-1]) III. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cpg-1 locus. Superficially wild type.
|
|
| DG4228 |
C. elegans |
orc-1(tn1732[mNeonGreen::3xflag::orc-1]) III. Show Description
Superficially wild type
|
|
| DQM1051 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1066 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1068 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1070 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| DQM1072 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| DV3208 |
C. elegans |
daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
|
|
| DV3285 |
C. elegans |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
|
|
| DV3312 |
C. elegans |
rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background.
Detection with triplex primers:
HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’
HS126 5’-TTGTCCTCCTCTCCCTTGG-3’
HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3'
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
| DV3327 |
C. elegans |
pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
| DV3525 |
C. elegans |
daf-15(re257[daf-15::mNG::AID*]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID* at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
|
|
| DV3651 |
C. elegans |
his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNeonGreen::2xFLAG]) X. Show Description
mTurqoise2 tag with linker sequence inserted into endogenous his-72 locus. mNeonGreen::2xFLAG tag inserted into endogenous yap-1 locus. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells, deficiency of wts-1 (Warts/LATS) causes translocation into nuclei of all cell types observed. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.
|
|
| DV3709 |
C. elegans |
ieSi57 II; unc-119(ed3) III; mig-15(re264[AID*::mNeonGreen::2xHA::mig-15]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::mNeonGreen::2xHA tag inserted into endogenous mig-15 locus. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of MIG-15 in somatic tissues. Auxin treatment causes locomotion defects, pVul, and weak Muv. Ubiquitous red fluorescence in cytoplasm. Ubiquitous mNeonGreen expression, some cytoplasmic, some localized to punctae and junctions. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Fakieh RA & Reiner DJ. Proc Natl Acad Sci USA. 2025 Jan 7;122(1):e2414321121. doi: 10.1073/pnas.2414321121. PMID: 39739816.
|
|
| DV4186 |
C. elegans |
his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNeonGreen::2xFLAG]) reDf4 X. Show Description
Mild uncharacterized Unc. reDf4 is a deletion of the tandemly duplicated cst-1 and cst-2 loci as well as intervening ncRNAs.
Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.
|
|
| EG10048 |
C. elegans |
oxSi1213 II. Show Description
oxSi1213 [loxP::mex-5p::FLP(G5D)::SL2::mNeongreen::FRT3]; inserted into jsSi1579. Generated by RMCE. Germline expressed Flp recombinase with transpliced mNeonGreen expression reporter. Animals have bright green fluorescent germlines and can recombine FRT sites with high efficiency. Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400.
|
|
| EG10276 |
C. elegans |
oxSi1356 II; unc-119(ox819) III. Show Description
oxSi1356 [attL::loxP::mex-5p::B3::let-858 3'UTR::glh-2 3'UTR::mNeongreen::SL2::PhiC31::mex-5p::rox::attR]; inserted into oxSi1270. Generated by PhIT. Germline expression of PhiC31 and B3 recombinases arranged in a convergent (tail-to-tail) manner. Unc; can be rescued by expression of the C. briggsae unc-119 gene (Cbr-unc-119). Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400.
|
|
| EG10420 |
C. elegans |
oxSi1228 II. Show Description
oxSi1228 [loxP::mex-5p::vika::SL2::mNeongreen::FRT3]; inserted into jsSi1579. Generated by RMCE. Germline expressed Vika recombinase with transpliced mNeonGreen expression reporter. Animals have bright green fluorescent germlines and can recombine vox sites with low efficiency. Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400.
|
|
| EG10441 |
C. elegans |
oxSi1284 II. Show Description
oxSi1284 [loxP::mex-5p::B3::SL2::mNeongreen::FRT3]; inserted into jsSi1579. Generated by RMCE. Germline expressed B3 recombinase with transpliced mNeonGreen expression reporter. Animals have bright green fluorescent germlines and can recombine B3RT sites. Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400.
|
|
| FDU1056 |
C. elegans |
mig-17(shc19[mig-17::mNG +LoxP]) V. Show Description
C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
|
|
| GLW16 |
C. elegans |
rab-7(utx12[mNG::rab-7]) II. Show Description
Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'
|
|
| GLW19 |
C. elegans |
mpk-1(utx14[mNG::mpk-1]) III. Show Description
Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'
|
|
| GLW2 |
C. elegans |
attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
|
|
| GLW25 |
C. elegans |
daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
| GLW33 |
C. elegans |
T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
| GLW35 |
C. elegans |
gldi-2(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
|
|
| GLW39 |
C. elegans |
ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
|
|
| GLW4 |
C. elegans |
gyf-1(utx4[gyf-1::mNG]) II. Show Description
Superficially wild-type. C-terminal tag of GYF-1 via CRISPR/Cas9 knock-in of mNeonGreen at gyf-1 locus. Insertion verified by PCR. Left flank: 5' CCATCGGCTCCGGTGAATCCTTCGCGCCGT 3'; Right flank: 5' TAGatgagtcatttctttttccagctttaa 3'. sgRNA: 5' TGACTCATCTAACGGCGCGA 3'
|
|
| GLW41 |
C. elegans |
nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
|
|
| GLW43 |
C. elegans |
edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
|
|
| GLW45 |
C. elegans |
ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
|
|
| GLW47 |
C. elegans |
hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
|
|
| GLW51 |
C. elegans |
cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
|
|