Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AV285 C. elegans swm-1(me66) him-5(e1490) V. Show Description
Sperm activation in virgin males. Poor sperm transfer.
BA836 C. elegans spe-26(it112) unc-22(e66) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
BA839 C. elegans spe-26(it118) unc-22(e66) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
BA966 C. elegans spe-27(it132) unc-22(e66) IV. Show Description
Temperature sensitive spe-27 allele. Hermaphrodites sterile at 25C; hermaphrodites produce 30-40 progeny/hermaphrodite at 16C. Males cannot mate due to the unc-22 mutation. Maintain at 15C.
BA970 C. elegans spe-6(hc163) III; spe-27(it132) unc-22(e66) IV. Show Description
Twitcher Unc. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C.
CB66 C. elegans unc-22(e66) IV. Show Description
Twitcher.
EE66 C. elegans mup-2(e2346) unc-6(e78) X. Show Description
Temperature sensitive. Maintain at 15C. At 25C the animals will arrest at 3-fold/L1 stage. Unc.
JR2750 C. elegans bli-6(sc16) unc-22(e66)/unc-24(e138) vha-17(w13) dpy-20(e2017) IV. Show Description
Pick wild type animals to maintain.
KK255 C. elegans dpy-20(e1282) unc-22(e66) IV. Show Description
Dpy. Twitcher.
KK299 C. elegans par-5(it55) unc-22(e66) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Twitchers which give only dead eggs, and dead eggs. nT1 heterozygotes are shorter and slower than par-5 unc-22 homozygous worms. par-5 region is not well balanced by nT1: check to make sure that unc-22 homozygotes lay dead eggs. Strict maternal effect lethal.
MT4574 C. elegans let-60(n1531)/let-60(n1046) unc-22(e66) IV. Show Description
Heterozygotes are WT and segregate WT, MuvUnc (n1046 e66) and n1531 homozygotes whose phenotypes range from a few dead larva to sterile adults. The normal larval lethality of n1531/n1531 is suppressed by the maternal contribution of n1046. n1046 is semi-dominant.
MT4700 C. elegans let-60(n1531) unc-22(e66)/let-60(n1700) dpy-20(e1282) IV; him-5(e1490) V. Show Description
Heterozygotes are mostly non-Muv (about 20% will be Muv because n1700 is semi-dominant) and non-Unc. Hets segregate Twitchers which die at various larval stages or as Vul adults, because of the maternal effect rescue of n1531 by n1700. The Twitchers will not give viable progeny. Hets also segregate DpyMuvs. The strain segregates males which will mate, though not very well.
MT4828 C. elegans let-60(n2031)/dpy-20(e1362) unc-22(e66) IV. Show Description
n2031 homozygotes are dead. n2031/dpy-20 unc-22 animals are Vul (27%) or WT (73%).
MT5726 C. elegans dpy-20(e1362) unc-22(e66) IV; him-5(e1490) V; nDp5 (IV;f). Show Description
Animals with the Duplication are WT. Animals which have lost the Duplication are Dpy and Twitchers. Throws both WT and DpyTwitcher males. Maintain by picking WT.
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
AML310 C. elegans wtfIs5; wtfEx258. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.
AML320 C. elegans otIs669 V; wtfIs145. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating wtfIs145. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623. Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML462 C. elegans otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623. Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
CB2842 C. elegans unc-58(e665e2112) X. Show Description
Intragenic revertant of dominant mutation e665. Slight uncoordinated phenotype.
CB3816 C. elegans tra-3(e1107) IV; unc-58(e665) sup-21(e1957) dpy-6(e14)/+ X. Show Description
Heterozygotes are Unc (shaker; don't move well) and segregate more Shaker Unc, WT and DpyUnc (short and fairly paralyzed). The WT give only males. e1957 previously called sup-21.
CB665 C. elegans unc-58(e665) X. Show Description
Shaker Unc. Reverts spontaneously. M-MATING-NO SUCCESS.
CB669 C. elegans unc-52(e669) II. Show Description
Unc-adults paralyzed. Dystrophic body muscle. Suppressed by sup-5 and sup-7. Null allele (?).
DR286 C. elegans him-8(e1489) IV; unc-58(e665) X. Show Description
Semi-dominant Unc-shaker. Segregates males.
HE250 C. elegans unc-52(e669su250) II. Show Description
Temperature sensitive Unc.
LE6655 C elegans tom-1(lq176) I; juIs76 II; lqIs345. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs345 [egl-17p::mCherry + gcy-32p::CFP + scm::GFP]. VD/DD axon guidance defects. lq176 is a short isoform-specific allele of tom-1. Reference: Mahadik SS & Lundquist EA. Development 2023 Apr 1;150(7):dev201031. Doi: 10.1242/dev.201031. PMID: 37014062
MT814 C. elegans unc-58(e665n273) X. Show Description
Revertant. WT.
MT831 C. elegans unc-58(e665n290) X. Show Description
Revertant. Not paralysed, but still somewhat Unc.
PHX3190 C elegans lgc-38(syb2346[flp-11p::dpy-10 site::flp-11UTR] syb3190[unc-58(e665)::linker(GSGSGSGSG)::mKate2]) III. Show Description
flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PJ104 C. elegans cad-1(j1) unc-52(e669) II. Show Description
Unc-progressive paralysis. Reduced cathepsin.
RE666 C. elegans ire-1(v33) II. Show Description
Slow growth. Abnormal tail.
RG3160 C. elegans T19A6.4(ve660[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctttggaaagttattcggtttgaagagtac ; Right flanking sequence: cagtgcagtacccctttcatggaagcccta. sgRNA #1: attcggtttgaagagtacga; sgRNA #2: aaaggggtactgcactgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3161 C. elegans Y53G8AR.6(ve661[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26]III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3162 C. elegans Y47G6A.18(ve662[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes Dpy and unhealthy. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Dpy adults (ve662 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: agaagaaacaaagaaatcccaaaaaaaaaa ; Right flanking sequence: Tatccgattattacagtattaaattctatc. sgRNA #1: aagaaaaaagaaacggtata; sgRNA #2: actgtaataatcggatATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3163 C. elegans Y47G6A.19(ve663[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3949 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaaatccaaaaaaaactcacCGGCAAATA ; Right flanking sequence: GTCAGCTCGATCCGTGTCAGCTGTCTCGAA. sgRNA #1: aaaactcacCGGCAAATATT; sgRNA #2: ACACGGATCGAGCTGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3164 C. elegans +/mT1 [umnIs52] II; Y39A1A.22(ve664[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are slow growing, Mel. Deletion of 2999 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve664 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaacctcccgaTTAGGTGTTAGTAGTGTCG ; Right flanking sequence: ggggaacactcattgatttaaatcatgatt. sgRNA #1: ATGAAAGTAGTAGTGACGAC; sgRNA #2: gcaaaaaaacacaatctcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3165 C. elegans Y39E4B.13(ve665[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2573 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttttttaaaaataaaatacgttattccca ; Right flanking sequence: gctacagtaacccgcgtggcgggacccaaa. sgRNA #1: atttattgtccgggaaatgt; sgRNA #2: accagtttcatctgtgtcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3166 C. elegans mek-2(ve666[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 4483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults(ve666 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: tagaatcaccccctggagctggagcatcct ; Right flanking sequence: cggggcgcacggaaattgcgtgcgcaacga. sgRNA #1: ctctttgtctctcactgtct; sgRNA #2: caagggatgttcactgcgcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3167 C. elegans Y54F10AM.5(ve667[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous larval arrest. Deletion of 1461 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve667 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aacttgtgtggatttacgggcaaacagccg ; Right flanking sequence: ACAATATTACTGAAAGCTAGatttctctga. sgRNA #1: ataaaatttgttttgcgcaa; sgRNA #2: AGCGCCAGTCGTTGTATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3168 C. elegans F21D5.7(ve668[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 2266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve668 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RG3169 C. elegans rpoa-49(ve669[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Show Description
Homozygous larval arrest. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ arrested larvae (ve669 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Left flanking Sequence: ATTGGAGCAGAGAAATGGGCTGAGAAACGT; Right flanking sequence: atattttacttattttttcttaaatctttt. sgRNA #3: GTTCGAATTCGAAGCGAACG; sgRNA #4: CGGAGGTTTCAAGAGAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SP1564 C. elegans mec-8(u218) smu-1(mn609) I; unc-52(e669su250) II. Show Description
Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.
SP1792 C. elegans smu-1(mn415) I; unc-52(e669su250) II. Show Description
Non-Unc at all temperatures. See also WBPaper00004764.
SP1804 C. elegans smu-2(mn416) unc-52(e669su250) II. Show Description
Non-Unc at all temperatures.
SP2123 C. elegans mec-8(u218) smu-1(mn602) I; unc-52(e669su250) II. Show Description
Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.
SP2642 C. elegans unc-36(e251) III; mnIs63. Show Description
mnIs63 [dpy-7p::unc-52(e669)(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP2668 C. elegans smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx142. Show Description
mnEx142 [smu-2::GFP + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
SP2686 C. elegans smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx151. Show Description
mnEx151 [smu-1::GFP + smu-2::3xHA + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
SP2693 C. elegans smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnIs66. Show Description
mnIs66 [smu-2::HA + unc-36(+)]. Strain should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.