RE666 |
C. elegans |
ire-1(v33) II. Show Description
Slow growth. Abnormal tail.
|
|
BR5486 |
C. elegans |
byIs162; bkIs10. Show Description
byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
BR5706 |
C. elegans |
byIs193; bkIs10. Show Description
byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
BR6427 |
C. elegans |
byIs194; bkIs10. Show Description
byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
BR6563 |
C. elegans |
byIs161; bkIs10. Show Description
byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
|
|
DV3312 |
C. elegans |
rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background.
Detection with triplex primers:
HS125 5-CTTGTCACTGTAAGGGAAGATTTCC-3
HS126 5-TTGTCCTCCTCTCCCTTGG-3
HS127 5 ACGTAGAATGTTCCAGAGTTCCAG-3'
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3313 |
C. elegans |
rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
|
|
DV3327 |
C. elegans |
pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
KAE112 |
C. elegans |
seaIs201. Show Description
seaIs201 [myo-3p::human tau (0N4R;V337M)::unc-54 3'UTR + vha-6p::mCherry::unc-54 3'UTR]. Reduced crawling speed, reduced brood size, shortened lifespan, slow development, early paralysis. Human tau transgene is expressed in body wall muscles, producing strong phenotypes suitable for screening and is sensitive to knockdown by feeding RNAi. Generated in N2 background.
|
|