More Fields
Strain Species Genotype
MT8666 C. elegans mek-2(n1989) I. Show Description
Weak allele of mek-2. 95% of the animals are WT. See also WBPaper00002150.
EJ255 C. elegans mek-2(q484) I; sDp2 (I;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are Sterile and Vul. At 15C rare animals will have a protruding vulva. At 20C and 25C animals with protruding vulva are more common, about 10%.
MH538 C. elegans mek-2(ku114) I; let-60(n1046) IV. Show Description
EJ238 C. elegans mek-2(q425) unc-11(e47) I; sDp2 (I;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are Unc, Sterile and Vul at all temperatures.
RG3166 C. elegans mek-2(ve666[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 4483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults(ve666 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: tagaatcaccccctggagctggagcatcct ; Right flanking sequence: cggggcgcacggaaattgcgtgcgcaacga. sgRNA #1: ctctttgtctctcactgtct; sgRNA #2: caagggatgttcactgcgcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MT7026 C. elegans mek-2(n2679)/sup-11(n403) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, steriles with a vulval defect, and scrawny Dpys. n2679 is a suppressor of let-60(n1046) Muv, and is recessive sterile with vulval defects. n267 is an intermediate strength allele. See also WBPaper00002150.
MT8667 C. elegans mek-2(n2678)/sup-11(n403) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, Sterile Vuls and scrawny Dpys. n2678 is a suppressor of let-60(n1046) Muv. n2678 animals are Vul and recessive sterile. n2678 is a strong allele, probably null. See also WBPaper00002150.
PJ1105 C. elegans mek-2(ku114) I; let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Occasional bags and L1 lethality. ga89 is temperature sensitive. Maintain at 16C.
PJ1124 C. elegans mek-2(ku114) I; clr-1(e1745) II; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl. Bags at high frequency. Semi-Clr.
KR638 C. elegans mek-2(h294) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Strain throws Unc and DpyUncLets. DpyUncLets arrest late larval. Maintain by picking Unc. let-537 and mek-2 fail to complement each other. See also WBPaper00002151 and WBPaper00002224.