More Fields
Strain Species Genotype
RG3169 C. elegans rpoa-49(ve669[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Show Description
Homozygous larval arrest. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ arrested larvae (ve669 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Left flanking Sequence: ATTGGAGCAGAGAAATGGGCTGAGAAACGT; Right flanking sequence: atattttacttattttttcttaaatctttt. sgRNA #3: GTTCGAATTCGAAGCGAACG; sgRNA #4: CGGAGGTTTCAAGAGAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.