CGC51 |
C. elegans |
sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.
|
|
BS7011 |
C. elegans |
nemp-1(oz534)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz534) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz534) homozygotes are sterile.
|
|
BS7012 |
C. elegans |
nemp-1(oz535)/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Segregates WT RFP+ heterozygotes, viable non-RFP nemp-1(oz535) homozygotes, and RFP+ Dpy. Maintain by picking wild-type RFP+. About 10-20% of nemp-1(oz535) homozygotes are sterile.
|
|
RG3088 |
C. elegans |
ddp-1(ve588[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygotes have small broods that never mature. Deletion of 401 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 have small broods that never mature (ve588 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatctatagtttttctcacaggaaATGGA; Right flanking sequence: ttaggctcttttccataaattttcccttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3121 |
C. elegans |
F53A3.7(ve621[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous Sterile. Deletion of 465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve621 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: agggtttctaaatatcttttaaaacctttg ; Right flanking sequence: AACGTCGTGACACGATAAAGAACGAGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3167 |
C. elegans |
Y54F10AM.5(ve667[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous larval arrest. Deletion of 1461 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve667 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aacttgtgtggatttacgggcaaacagccg ; Right flanking sequence: ACAATATTACTGAAAGCTAGatttctctga. sgRNA #1: ataaaatttgttttgcgcaa; sgRNA #2: AGCGCCAGTCGTTGTATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|