| GG37 |
C. elegans |
let-2(g37) X. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00001806.
|
|
| CB7181 |
C. elegans |
bus-8B(e2883e3071) X. Show Description
Weak Bus, viable on Leucobacter Verde1. e3071 is a missense intragenic revertant (P97S) of e2883 (G378E). Reference: Stroud et al (in preparation).
|
|
| CL2621 |
C. elegans |
smg-1(cc546) I; dvIs75. Show Description
dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| DG3784 |
C. elegans |
lin-41(tn1487) I. Show Description
Temperature-sensitive sterile. Maintain at 15C. Reference: Spike CA, et al. Genetics. 2014 Sep 26. pii: genetics.114.168831.
|
|
| GR1814 |
C. elegans |
eri-6(mg379) I. Show Description
Reference: Fischer SE, et al. Nature. 2008 Sep 25;455(7212):491-6.
|
|
| TG3796 |
C. elegans |
bub-3(gt2000) II. Show Description
Y54G9A.6. Nonsense C to T transition. IR sensitive. To genotype: WT left mismatch primer: GAAACAGGCAACGGAACAC; mutant left mismatch primer: GAAACAGGCAACGGAAACT; right mismatch primer: CTCTTCATCATCTCCTCTCC. WT and mutant amplicon: 407 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
|
|
| YY11 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi. Sterile at 25 degrees. Referenced in Pavelec et al. Genetics (2009).
|
|
| YY13 |
C. elegans |
rrf-3(mg373) II; oxls12. Show Description
oxls12 [unc-47p::GFP + lin-15(+)]. Enhanced RNAi. Sterile at 25 degrees. [NOTE: the genotype of YY13 as previously annotated only as rrf-3(mg373)] References: Pavelec DM, et al. Genetics. 2009 Dec;183(4):1283-95. PMID: 19797044. McIntire SL, et al. Nature. 1997 Oct 23;389(6653):870-6. PMID: 9349821.
|
|
| YY470 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
|
|